Dataset for CDS MCL-1 of organism Rhinolophus ferrumequinum

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A671G0G2_MCL1-01      atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtgg
A0A671G0G2_MCL1-02      atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtgg
A0A671G0G2_MCL1-03      atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtgg
                        **************************************************

A0A671G0G2_MCL1-01      ggggtccgggttaggggccggcagcggcggcagcgcctccccttcgggag
A0A671G0G2_MCL1-02      ggggtccgggttaggggccggcagcggcggcagcgcctccccttcgggag
A0A671G0G2_MCL1-03      ggggtccgggttaggggccggcagcggcggcagcgcctccccttcgggag
                        **************************************************

A0A671G0G2_MCL1-01      agcggcttctggccgcggggaaggaggccaccgcccggcgagaggcaggg
A0A671G0G2_MCL1-02      agcggcttctggccgcggggaaggaggccaccgcccggcgagaggcaggg
A0A671G0G2_MCL1-03      agcggcttct----------------------------------------
                        **********                                        

A0A671G0G2_MCL1-01      ggaggggaagccggtgcggtgattggcggaagcgccggcgcgagcccccc
A0A671G0G2_MCL1-02      ggaggggaagccggtgcggtgattggcggaagcgccggcgcgagcccccc
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671G0G2_MCL1-01      ggccactctcgcgccggacgcccggagggtcgcgcggccctcgcccattg
A0A671G0G2_MCL1-02      ggccactctcgcgccggacgcccggagggtcgcgcggccctcgcccattg
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671G0G2_MCL1-01      gcgccgagagccccgacgtcacggcgacccccgcgaggcggctgttcttc
A0A671G0G2_MCL1-02      gcgccgagagccccgacgtcacggcgacccccgcgaggcggctgttcttc
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671G0G2_MCL1-01      gcgccctccttccgcgcgtcgccgcttaaggagatggaagccccggccgc
A0A671G0G2_MCL1-02      gcgccctccttccgcgcgtcgccgcttaaggagatggaagccccggccgc
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671G0G2_MCL1-01      cgacgccatcatgtcgcccgaagaggaactggacgggtacgagccggagc
A0A671G0G2_MCL1-02      cgacgccatcatgtcgcccgaagaggaactggacgggtacgagccggagc
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671G0G2_MCL1-01      ctctcgggaagcggccggctgtcctgcccttgctagagcgggtcgaggag
A0A671G0G2_MCL1-02      ctctcgggaagcggccggctgtcctgcccttgctagagcgggtcgaggag
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671G0G2_MCL1-01      gccagtaatggacccggtatgagcggctcactgccctctacgccgccccc
A0A671G0G2_MCL1-02      gccagtaatggacccggtatgagcggctcactgccctctacgccgccccc
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671G0G2_MCL1-01      cgcagaggaggaggaggaggacgagttgtaccggcagtcgctggagatta
A0A671G0G2_MCL1-02      cgcagaggaggaggaggaggacgagttgtaccggcagtcgctggagatta
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671G0G2_MCL1-01      tctctcggtaccttcgggagcaggcgaccggcgccaaggacgcgaagcca
A0A671G0G2_MCL1-02      tctctcggtaccttcgggagcaggcgaccggcgccaaggacgcgaagcca
A0A671G0G2_MCL1-03      ----------------------ggcgaccggcgccaaggacgcgaagcca
                                              ****************************

A0A671G0G2_MCL1-01      atgggcaggtctgcgtccgccagccgcaaggcgttagacacccttcggcg
A0A671G0G2_MCL1-02      atgggcaggtctgcgtccgccagccgcaaggcgttagacacccttcggcg
A0A671G0G2_MCL1-03      atgggcaggtctgcgtccgccagccgcaaggcgttagacacccttcggcg
                        **************************************************

A0A671G0G2_MCL1-01      ggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgc
A0A671G0G2_MCL1-02      ggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgc
A0A671G0G2_MCL1-03      ggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgc
                        **************************************************

A0A671G0G2_MCL1-01      ttcggaaactggacatcaaaaacgaagacgacgtcaaatctttgtctcga
A0A671G0G2_MCL1-02      ttcggaaactggacatcaaaaacgaagacgacgtcaaatctttgtctcga
A0A671G0G2_MCL1-03      ttcggaaactggacatcaaaaacgaagacgacgtcaaatctttgtctcga
                        **************************************************

A0A671G0G2_MCL1-01      gtgatgattcacgtttttagtgacggagtaacaaactggggcaggattgt
A0A671G0G2_MCL1-02      gtgatgattcacgtttttagtgacggagtaacaaactggggcaggattgt
A0A671G0G2_MCL1-03      gtgatgattcacgtttttagtgacggagtaacaaactggggcaggattgt
                        **************************************************

A0A671G0G2_MCL1-01      gactcttatttcttttggtgcctttgtggccaaacacttgaagagtataa
A0A671G0G2_MCL1-02      gactcttatttcttttggtgcctttgtggccaaacacttgaagagtataa
A0A671G0G2_MCL1-03      gactcttatttcttttggtgcctttgtggccaaacacttgaagagtataa
                        **************************************************

A0A671G0G2_MCL1-01      accaagaaagctgcatcgaaccattagcagaaagcatcacagatgttctc
A0A671G0G2_MCL1-02      accaagaaagctgcatcgaaccattagcagaaagcatcacagatgttctc
A0A671G0G2_MCL1-03      accaagaaagctgcatcgaaccattagcagaaagcatcacagatgttctc
                        **************************************************

A0A671G0G2_MCL1-01      gtaaggacaaaacgagactggctagtcaaacaaagaggctggagaatgcc
A0A671G0G2_MCL1-02      gtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtt
A0A671G0G2_MCL1-03      gtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtt
                        ******************************************     *  

A0A671G0G2_MCL1-01      agcaagacaagtgcacttcgaagcagaggagc-aggacacaggaccaaaa
A0A671G0G2_MCL1-02      tgt------ggagttcttccacgtagaggacctagaaggcggcatcagaa
A0A671G0G2_MCL1-03      tgt------ggagttcttccacgtagaggacctagaaggcggcatcagaa
                         *        * *  **** * * ****** * ** *  * * * ** **

A0A671G0G2_MCL1-01      ------tcctggcc----caagt-----tgagttctgagcagtactgttg
A0A671G0G2_MCL1-02      atgtgctgctggcttttgcaggtgttgctggagtcggagctggtctggca
A0A671G0G2_MCL1-03      atgtgctgctggcttttgcaggtgttgctggagtcggagctggtctggca
                              * *****     ** **     **   ** **** *  ***   

A0A671G0G2_MCL1-01      ctcctgttga-----
A0A671G0G2_MCL1-02      tatctaataagatag
A0A671G0G2_MCL1-03      tatctaataagatag
                           **  * *     

© 1998-2020Legal notice