Dataset for CDS MCL-1 of organism Ornithorhynchus anatinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6I8NSR7_MCL1-01      atgctgggcctgcagaagaacgccgtcatcggcctcaacctctactgcgg
A0A6I8NSR7_MCL1-02      atgctgggcctgcagaagaacgccgtcatcggcctcaacctctactgcgg
                        **************************************************

A0A6I8NSR7_MCL1-01      gggcgccggcagcggcgcgggggcctccccgcccggagggcgcctgcggc
A0A6I8NSR7_MCL1-02      gggcgccggcagcggcgcgggggcctccccgcccggagggcgcctgcggc
                        **************************************************

A0A6I8NSR7_MCL1-01      ccgacaaggcggcggcggtcggcgagggcccggcggcggcggcggcggcg
A0A6I8NSR7_MCL1-02      ccgacaaggcggcggcggtcggcgagggcccggcggcggcggcggcggcg
                        **************************************************

A0A6I8NSR7_MCL1-01      gcggcccggcgcgcgggcgggggaggggaggccgcggcgccgctgattgg
A0A6I8NSR7_MCL1-02      gcggcccggcgcgcgggcgggggaggggaggccgcggcgccgctgattgg
                        **************************************************

A0A6I8NSR7_MCL1-01      cggaggcgccggcgcgagcccctcggcggcggccggcctgggggtcgcgc
A0A6I8NSR7_MCL1-02      cggaggcgccggcgcgagcccctcggcggcggccggcctgggggtcgcgc
                        **************************************************

A0A6I8NSR7_MCL1-01      gcccggcccccattggcgccgagggccctgacgtcatcgggaccctcgcg
A0A6I8NSR7_MCL1-02      gcccggcccccattggcgccgagggccctgacgtcatcgggaccctcgcg
                        **************************************************

A0A6I8NSR7_MCL1-01      cccgcccggcgcgcgccgcctgaggggacggagccgccgccgccgtcggc
A0A6I8NSR7_MCL1-02      cccgcccggcgcgcgccgcctgaggggacggagccgccgccgccgtcggc
                        **************************************************

A0A6I8NSR7_MCL1-01      cgccgccgccgccgccgccctcctccgccccgaggacgaactggacggct
A0A6I8NSR7_MCL1-02      cgccgccgccgccgccgccctcctccgccccgaggacgaactggacggct
                        **************************************************

A0A6I8NSR7_MCL1-01      acgagcccgaggccccggccaaacgtccggcccacctggccgtgctggac
A0A6I8NSR7_MCL1-02      acgagcccgaggccccggccaaacgtccggcccacctggccgtgctggac
                        **************************************************

A0A6I8NSR7_MCL1-01      ctgcccggccaggccggcggctccctgccctccacgccgccgcccgacga
A0A6I8NSR7_MCL1-02      ctgcccggccaggccggcggctccctgccctccacgccgccgcccgacga
                        **************************************************

A0A6I8NSR7_MCL1-01      ccgcgacgacatggcggacgggctgtaccgccagtccctggagctcatca
A0A6I8NSR7_MCL1-02      ccgcgacgacatggcggacgggctgtaccgccagtccctggagctcatca
                        **************************************************

A0A6I8NSR7_MCL1-01      cccactacctccgcgagcaggcggccggacggaaggacgagccccggggc
A0A6I8NSR7_MCL1-02      cccactacctccgcgagcaggcggccggacggaaggacgagccccggggc
                        **************************************************

A0A6I8NSR7_MCL1-01      cgggaccgccgggcgctggagaccctgaggagggtgggcgacggcatcca
A0A6I8NSR7_MCL1-02      cgggaccgccgggcgctggagaccctgaggagggtgggcgacggcatcca
                        **************************************************

A0A6I8NSR7_MCL1-01      gcgcaaccacgagaccgccttccagggtgagggaggcctccggcgcatgc
A0A6I8NSR7_MCL1-02      gcgcaaccacgagaccgccttccag-------------------------
                        *************************                         

A0A6I8NSR7_MCL1-01      gcgaagcgggcgcgcccctccccccccctccgtcctacgtactgagcgcc
A0A6I8NSR7_MCL1-02      --------------------------------------------------
                                                                          

A0A6I8NSR7_MCL1-01      ctcccggagcctaatggcacccctccccccccccccgtcccctctccccg
A0A6I8NSR7_MCL1-02      --------------------------------------------------
                                                                          

A0A6I8NSR7_MCL1-01      caggcatgctccgcaagctggacatccagaaggaggaggacctgaaggcc
A0A6I8NSR7_MCL1-02      --ggcatgctccgcaagctggacatccagaaggaggaggacctgaaggcc
                          ************************************************

A0A6I8NSR7_MCL1-01      gtgtcccgcgtcggcacccacgttttcaacgacgggacgacgaactgggg
A0A6I8NSR7_MCL1-02      gtgtcccgcgtcggcacccacgttttcaacgacgggacgacgaactgggg
                        **************************************************

A0A6I8NSR7_MCL1-01      ccgcatcgtgacgctcatctctttcggcgccttcgtggccaagcacttga
A0A6I8NSR7_MCL1-02      ccgcatcgtgacgctcatctctttcggcgccttcgtggccaagcacttga
                        **************************************************

A0A6I8NSR7_MCL1-01      agagcatcaaccaggagggctgcatcgaccccctggccgagagcatcacg
A0A6I8NSR7_MCL1-02      agagcatcaaccaggagggctgcatcgaccccctggccgagagcatcacg
                        **************************************************

A0A6I8NSR7_MCL1-01      gaggtcctggtgaccaccaagagggactggctggtcaaacagaaaggctg
A0A6I8NSR7_MCL1-02      gaggtcctggtgaccaccaagagggactggctggtcaaacagaaaggctg
                        **************************************************

A0A6I8NSR7_MCL1-01      ggaaggatttgtggaattcttccacgtggaggacatggaaggcagcgtcc
A0A6I8NSR7_MCL1-02      ggaaggatttgtggaattcttccacgtggaggacatggaaggcagcgtcc
                        **************************************************

A0A6I8NSR7_MCL1-01      ggaacgtgctcctgctcttcgccggggtggccagcctgggagccggcttg
A0A6I8NSR7_MCL1-02      ggaacgtgctcctgctcttcgccggggtggccagcctgggagccggcttg
                        **************************************************

A0A6I8NSR7_MCL1-01      gcctatctaataagatgatggggggacccccccccccttccccctcggac
A0A6I8NSR7_MCL1-02      gcctatctaataagatga--------------------------------
                        ******************                                

A0A6I8NSR7_MCL1-01      gctcagagactgacttcacatcggagcagaccagccccaggcgccggcca
A0A6I8NSR7_MCL1-02      --------------------------------------------------
                                                                          

A0A6I8NSR7_MCL1-01      cccgtcggaactgtcgcttctgccgccgggaagctttatttatgaagccc
A0A6I8NSR7_MCL1-02      --------------------------------------------------
                                                                          

A0A6I8NSR7_MCL1-01      agcgtccagccgcccagaattggcaccgacaggcaccgagcggcggccca
A0A6I8NSR7_MCL1-02      --------------------------------------------------
                                                                          

A0A6I8NSR7_MCL1-01      gccaggcaagagggtttgggctggtttggggacggatattaa
A0A6I8NSR7_MCL1-02      ------------------------------------------
                                                                  

© 1998-2020Legal notice