Dataset for CDS MCL-1 of organism Ornithorhynchus anatinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A6I8NSR7_MCL1-01      atgctgggcctgcagaagaacgccgtcatcggcctcaacctctactgcgg
A0A6I8NSR7_MCL1-02      atgctgggcctgcagaagaacgccgtcatcggcctcaacctctactgcgg

A0A6I8NSR7_MCL1-01      gggcgccggcagcggcgcgggggcctccccgcccggagggcgcctgcggc
A0A6I8NSR7_MCL1-02      gggcgccggcagcggcgcgggggcctccccgcccggagggcgcctgcggc

A0A6I8NSR7_MCL1-01      ccgacaaggcggcggcggtcggcgagggcccggcggcggcggcggcggcg
A0A6I8NSR7_MCL1-02      ccgacaaggcggcggcggtcggcgagggcccggcggcggcggcggcggcg

A0A6I8NSR7_MCL1-01      gcggcccggcgcgcgggcgggggaggggaggccgcggcgccgctgattgg
A0A6I8NSR7_MCL1-02      gcggcccggcgcgcgggcgggggaggggaggccgcggcgccgctgattgg

A0A6I8NSR7_MCL1-01      cggaggcgccggcgcgagcccctcggcggcggccggcctgggggtcgcgc
A0A6I8NSR7_MCL1-02      cggaggcgccggcgcgagcccctcggcggcggccggcctgggggtcgcgc

A0A6I8NSR7_MCL1-01      gcccggcccccattggcgccgagggccctgacgtcatcgggaccctcgcg
A0A6I8NSR7_MCL1-02      gcccggcccccattggcgccgagggccctgacgtcatcgggaccctcgcg

A0A6I8NSR7_MCL1-01      cccgcccggcgcgcgccgcctgaggggacggagccgccgccgccgtcggc
A0A6I8NSR7_MCL1-02      cccgcccggcgcgcgccgcctgaggggacggagccgccgccgccgtcggc

A0A6I8NSR7_MCL1-01      cgccgccgccgccgccgccctcctccgccccgaggacgaactggacggct
A0A6I8NSR7_MCL1-02      cgccgccgccgccgccgccctcctccgccccgaggacgaactggacggct

A0A6I8NSR7_MCL1-01      acgagcccgaggccccggccaaacgtccggcccacctggccgtgctggac
A0A6I8NSR7_MCL1-02      acgagcccgaggccccggccaaacgtccggcccacctggccgtgctggac

A0A6I8NSR7_MCL1-01      ctgcccggccaggccggcggctccctgccctccacgccgccgcccgacga
A0A6I8NSR7_MCL1-02      ctgcccggccaggccggcggctccctgccctccacgccgccgcccgacga

A0A6I8NSR7_MCL1-01      ccgcgacgacatggcggacgggctgtaccgccagtccctggagctcatca
A0A6I8NSR7_MCL1-02      ccgcgacgacatggcggacgggctgtaccgccagtccctggagctcatca

A0A6I8NSR7_MCL1-01      cccactacctccgcgagcaggcggccggacggaaggacgagccccggggc
A0A6I8NSR7_MCL1-02      cccactacctccgcgagcaggcggccggacggaaggacgagccccggggc

A0A6I8NSR7_MCL1-01      cgggaccgccgggcgctggagaccctgaggagggtgggcgacggcatcca
A0A6I8NSR7_MCL1-02      cgggaccgccgggcgctggagaccctgaggagggtgggcgacggcatcca

A0A6I8NSR7_MCL1-01      gcgcaaccacgagaccgccttccagggtgagggaggcctccggcgcatgc
A0A6I8NSR7_MCL1-02      gcgcaaccacgagaccgccttccag-------------------------

A0A6I8NSR7_MCL1-01      gcgaagcgggcgcgcccctccccccccctccgtcctacgtactgagcgcc
A0A6I8NSR7_MCL1-02      --------------------------------------------------

A0A6I8NSR7_MCL1-01      ctcccggagcctaatggcacccctccccccccccccgtcccctctccccg
A0A6I8NSR7_MCL1-02      --------------------------------------------------

A0A6I8NSR7_MCL1-01      caggcatgctccgcaagctggacatccagaaggaggaggacctgaaggcc
A0A6I8NSR7_MCL1-02      --ggcatgctccgcaagctggacatccagaaggaggaggacctgaaggcc

A0A6I8NSR7_MCL1-01      gtgtcccgcgtcggcacccacgttttcaacgacgggacgacgaactgggg
A0A6I8NSR7_MCL1-02      gtgtcccgcgtcggcacccacgttttcaacgacgggacgacgaactgggg

A0A6I8NSR7_MCL1-01      ccgcatcgtgacgctcatctctttcggcgccttcgtggccaagcacttga
A0A6I8NSR7_MCL1-02      ccgcatcgtgacgctcatctctttcggcgccttcgtggccaagcacttga

A0A6I8NSR7_MCL1-01      agagcatcaaccaggagggctgcatcgaccccctggccgagagcatcacg
A0A6I8NSR7_MCL1-02      agagcatcaaccaggagggctgcatcgaccccctggccgagagcatcacg

A0A6I8NSR7_MCL1-01      gaggtcctggtgaccaccaagagggactggctggtcaaacagaaaggctg
A0A6I8NSR7_MCL1-02      gaggtcctggtgaccaccaagagggactggctggtcaaacagaaaggctg

A0A6I8NSR7_MCL1-01      ggaaggatttgtggaattcttccacgtggaggacatggaaggcagcgtcc
A0A6I8NSR7_MCL1-02      ggaaggatttgtggaattcttccacgtggaggacatggaaggcagcgtcc

A0A6I8NSR7_MCL1-01      ggaacgtgctcctgctcttcgccggggtggccagcctgggagccggcttg
A0A6I8NSR7_MCL1-02      ggaacgtgctcctgctcttcgccggggtggccagcctgggagccggcttg

A0A6I8NSR7_MCL1-01      gcctatctaataagatgatggggggacccccccccccttccccctcggac
A0A6I8NSR7_MCL1-02      gcctatctaataagatga--------------------------------

A0A6I8NSR7_MCL1-01      gctcagagactgacttcacatcggagcagaccagccccaggcgccggcca
A0A6I8NSR7_MCL1-02      --------------------------------------------------

A0A6I8NSR7_MCL1-01      cccgtcggaactgtcgcttctgccgccgggaagctttatttatgaagccc
A0A6I8NSR7_MCL1-02      --------------------------------------------------

A0A6I8NSR7_MCL1-01      agcgtccagccgcccagaattggcaccgacaggcaccgagcggcggccca
A0A6I8NSR7_MCL1-02      --------------------------------------------------

A0A6I8NSR7_MCL1-01      gccaggcaagagggtttgggctggtttggggacggatattaa
A0A6I8NSR7_MCL1-02      ------------------------------------------

© 1998-2021Legal notice