Dataset for CDS BAX of Organism Leptobrachium leishanense

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5PKU5_BAX-03      atggcggagaaaggagccggcggggactggccatctgtgtgcgaaggagc
A0A8C5PKU5_BAX-04      atggcggagaaaggagccggcggggactggccatctgtgtgcgaaggagc
A0A8C5PKU5_BAX-01      atggcggagaaaggagccggcggggactggccatctgtgtgcgaaggagc
A0A8C5PKU5_BAX-02      atgat----------accgctctggatt----------------------
                       ***             ***    *** *                      

A0A8C5PKU5_BAX-03      cacggggggagagaacccggaagcggccggcaacggaagccgaacag---
A0A8C5PKU5_BAX-04      cacggggggagagaacccggaagcggccggcaacggaagccgaacag---
A0A8C5PKU5_BAX-01      cacggggggagagaacccggaagcggccggcaacggaagccgaacagctg
A0A8C5PKU5_BAX-02      -----------------tggatgcttctgggggctg--------cagctg
                                         *** **  * **   * *        ***   

A0A8C5PKU5_BAX-03      ----------ggacaagcacagaacagattgtgga-gacggggaacgtgc
A0A8C5PKU5_BAX-04      ----------ggacaagcacagaacagattgtgga-gacggggaacgtgc
A0A8C5PKU5_BAX-01      cggcaccgctggatgatgaca----agatcatcaatggctatgaatgtcc
A0A8C5PKU5_BAX-02      cggcaccgctggatgatgaca----agatcatcaatggctatgaatgtcc
                                 ***  *  ***    ****  *  * * *   *** ** *

A0A8C5PKU5_BAX-03      tgctcaat------------gggttcattgctgaccaagttcagaggaca
A0A8C5PKU5_BAX-04      tgctcaat------------gggttcattgctgaccaagttcagaggaca
A0A8C5PKU5_BAX-01      ccgtcactcccagccgtggcaggtgtatttc--acctataaaggtgaacg
A0A8C5PKU5_BAX-02      ccgtcactcccagccgtggcaggtgtatttc--acctataaaggtgaacg
                          *** *             ***  *** *  *** *     * * ** 

A0A8C5PKU5_BAX-03      cca----aatagacctactgatgcattggcagagcttggggtgcagtcag
A0A8C5PKU5_BAX-04      cca----aatagacctactgatgcattggcagagcttggggtgcagtcag
A0A8C5PKU5_BAX-01      ctggtgcggcgggtct-ctgatcaattcacaatg----------gatcat
A0A8C5PKU5_BAX-02      ctggtgcggcgggtct-ctgatcaattcacaatg----------gatcat
                       *          *  ** *****  ***  **  *            *** 

A0A8C5PKU5_BAX-03      ctccggcggaccctcggacaaaggaactcagtgagtgcctgcgtaaaatt
A0A8C5PKU5_BAX-04      ctccggcggaccctcggacaaaggaactcagtgagtgcctgcgtaaaatt
A0A8C5PKU5_BAX-01      ctcagcagcacattgttacaaatcacccaagtatttaattgc-tcatctt
A0A8C5PKU5_BAX-02      ctcagcagcacattgttacaaatcacccaagtatttaattgc-tcatctt
                       *** *  * **  *   *****  * *  ***   *   *** * *  **

A0A8C5PKU5_BAX-03      ggagatgaactggatggaaacatggagctacagagaatgattgaacaggt
A0A8C5PKU5_BAX-04      ggagatgaactggatggaaacatggagctacagagaatgattgaacaggt
A0A8C5PKU5_BAX-01      g--------------gggaacatgacaccacaaaggaaga------agga
A0A8C5PKU5_BAX-02      g--------------gggaacatgacaccacaaaggaaga------agga
                       *              ** ******   * *** ** * **      *** 

A0A8C5PKU5_BAX-03      acaaagcgattctcccaag-gaag--------------tctttttcaaag
A0A8C5PKU5_BAX-04      acaaagcgattctcccaag-gaag--------------tctttttcaaag
A0A8C5PKU5_BAX-01      acagagcaacatattcaagtgaagaacgcatatcaatatttctactataa
A0A8C5PKU5_BAX-02      acagagcaacatattcaagtgaagaacgcatatcaatatttctactataa
                       *** *** *      **** ****              * * *   * * 

A0A8C5PKU5_BAX-03      tagcatccgaa------atgttttc-tgatgggaattttaactggggccg
A0A8C5PKU5_BAX-04      tagcatccgaa------atgttttc-tgatgggaattttaactggggccg
A0A8C5PKU5_BAX-01      caacaattacatggaccacgacttcatgatggtgaaattagcagagccag
A0A8C5PKU5_BAX-02      caacaattacatggaccacgacttcatgatggtgaaattagcagagccag
                        * **     *      * *  *** ******  *  *** * * * * *

A0A8C5PKU5_BAX-03      agtggtcgcgctcttctattttgct--tcaaggcttattataaagcacca
A0A8C5PKU5_BAX-04      agtggtcgcgctcttctattttgct--tcaaggcttattata--------
A0A8C5PKU5_BAX-01      cacagttcaaccaatacgtgcagcccatcaaagtagccagtagttgtcca
A0A8C5PKU5_BAX-02      cacagttcaaccaatacgtgcagcccatcaaagtagccagtagttgtcca
                           **    *   *   *   **   **** *       **        

A0A8C5PKU5_BAX-03      atgtccacttgacacatttataatgagccatgctgctactcccctcgttt
A0A8C5PKU5_BAX-04      --------------------------------------------------
A0A8C5PKU5_BAX-01      a-------------------------------ctgccagtactcagtgtc
A0A8C5PKU5_BAX-02      a-------------------------------ctgccagtactcagtgtc
                                                                         

A0A8C5PKU5_BAX-03      gccacgccgtgggcaaggccttgttgacaaacgttccaaaaattacccgt
A0A8C5PKU5_BAX-04      --------------aaggccttgttgacaaacgttccaaaaattacccgt
A0A8C5PKU5_BAX-01      tggtgtctggatgggggaacctgctgacatctggtgtgaagtatcctgat
A0A8C5PKU5_BAX-02      tggtgtctggatgggggaacctgctgacatctggtgtgaagtatcctgat
                                       *  * ** *****   * *   **   * *   *

A0A8C5PKU5_BAX-03      -accatcattgattgga---------------caatggaa----------
A0A8C5PKU5_BAX-04      -accatcattgattgga---------------caatggaa----------
A0A8C5PKU5_BAX-01      ggcctccagtgtttggagatccccgttctctccgaggaaagctgcaaagc
A0A8C5PKU5_BAX-02      ggcctccagtgtttggagatccccgttctctccgaggaaagctgcaaagc
                         **  ** ** *****               * * * **          

A0A8C5PKU5_BAX-03      -------tactttcgagtca--------atgttgtgcagtggattcggga
A0A8C5PKU5_BAX-04      -------tactttcgagtca--------atgttgtgcagtggattcggga
A0A8C5PKU5_BAX-01      gtcttattcctatcaggttacttcaaacatgttctgcgccggcttc----
A0A8C5PKU5_BAX-02      gtcttattcctatcaggttacttcaaacatgttctgcgccggcttc----
                              * ** **  ** *        ***** ***   ** ***    

A0A8C5PKU5_BAX-03      tcagggaggctgggaaaatatcatttca---tacgtcagcactcctact-
A0A8C5PKU5_BAX-04      tcagggaggctgggaaaatatcatttca---tacgtcagcactcctact-
A0A8C5PKU5_BAX-01      -caggatgga-gggaaagactcgtgtcagggtgactctggaggaccactg
A0A8C5PKU5_BAX-02      -caggatgga-gggaaagactcgtgtcagggtgactctggaggaccactg
                        ****  **  ******   ** * ***   *   ** * *   * *** 

A0A8C5PKU5_BAX-03      ---------------------------------tggcaaacagtttgtat
A0A8C5PKU5_BAX-04      ---------------------------------tggcaaacagtttgtat
A0A8C5PKU5_BAX-01      gcctgtaatggagagctttatggagtggtatcgtggggaaaaggctgcgc
A0A8C5PKU5_BAX-02      gcctgtaatggagagctttatggagtggtatcgtggggaaaaggctgcgc
                                                        ***  ** **  **   

A0A8C5PKU5_BAX-03      ct------tcttctccggtgta---------------------ttag-ct
A0A8C5PKU5_BAX-04      ct------tcttctccggtgta---------------------ttag-ct
A0A8C5PKU5_BAX-01      ccagagaggttaccccggcgtatacaccaaagtgtgcaactacttagact
A0A8C5PKU5_BAX-02      ccagagaggttaccccggcgtatacaccaaagtgtgcaactacttagact
                       *         * * **** ***                     **** **

A0A8C5PKU5_BAX-03      gccgcctttaccatctggaggatgaagtga
A0A8C5PKU5_BAX-04      gccgcctttaccatctggaggatgaagtga
A0A8C5PKU5_BAX-01      ggatcctgcatgtcattgacaatt-attaa
A0A8C5PKU5_BAX-02      ggatcctgcatgtcattgacaatt-attaa
                       *   ***  *     * **  **  * * *

© 1998-2023Legal notice