Dataset for CDS MCL-1 of organism Oncorhynchus mykiss

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8K9V051_MCL1-01      atg-gcatgtcctgacattggtaac-cgcgtcaaggcaacgttgaagcat
A0A8C7LPD4_MCL1-01      atgagtctgtc--gaagtcgattgcacgagccacaactacgatgttgcat
A0A8C7PM33_MCL1-03      atgagtctgtc--gaagtcgattacacgagccacaactacgatgttgaat
A0A8C7PM33_MCL1-01      atgagtctgtc--gaagtcgattacacgagccacaactacgatgttgaat
A0A8C7PM33_MCL1-02      atgagtctgtc--gaagtcgattacacgagccacaactacgatgttgaat
                        *** *  ****  **  * * *  * ** * **   * *** **  * **

A0A8K9V051_MCL1-01      ctgaaa---------gtggcagggtctatcgacag------------cac
A0A8C7LPD4_MCL1-01      tttcaaaa---------tggaggatcttcgtacctagctgatgatgctag
A0A8C7PM33_MCL1-03      tttcaaaatggagtcgttggaggctcttcgtaccctgctgg------tac
A0A8C7PM33_MCL1-01      tttcaaaatggagtcgttggaggctcttcgtaccctgctgg------tac
A0A8C7PM33_MCL1-02      tttcaaaatggagtcgttggaggctcttcgtaccctgctgg------tac
                         *  **            * *** ***    **               * 

A0A8K9V051_MCL1-01      tcctttgttcactagcaga------ggacctgaacatgagtacagatggg
A0A8C7LPD4_MCL1-01      ccctttgtactatttcgac------ggggccgtatgt-------gctgcg
A0A8C7PM33_MCL1-03      ctctttgtactatttcggcgagactggggctgtacgt-------gctggg
A0A8C7PM33_MCL1-01      ctctttgtactatttcggcgagactggggctgtacgt-------gctggg
A0A8C7PM33_MCL1-02      ctctttgtactatttcggcgagactggggctgtacgt-------gctggg
                          ****** *  *  *         **  * * *  *       * ** *

A0A8K9V051_MCL1-01      gagacctcgaaacggatagctccttagcttacggcagcaaacactttggt
A0A8C7LPD4_MCL1-01      gcgtcaccga---------------agtctaaagtg------gacttgg-
A0A8C7PM33_MCL1-03      gcgtcaccga---------------agtcaaaagtggatactgacttgg-
A0A8C7PM33_MCL1-01      gcgtcaccga---------------agtcaaaagtggatactgacttgg-
A0A8C7PM33_MCL1-02      gcgtcaccga---------------agtcaaaagtggatactgacttgg-
                        * * *  ***               **   *  *           **** 

A0A8K9V051_MCL1-01      gtactaggagagtctgccaaca-tgtaccaccttccaaatacggttgaca
A0A8C7LPD4_MCL1-01      gaaatggga----ccggcgatactccaccac---------------gacc
A0A8C7PM33_MCL1-03      gtaatggga----ctggcgacactccaccac---------------gacc
A0A8C7PM33_MCL1-01      gtaatggga----ctggcgacactccaccac---------------gacc
A0A8C7PM33_MCL1-02      gtaatggga----ctggcgacactccaccac---------------gacc
                        * * * ***    * * * * * *  *****               *** 

A0A8K9V051_MCL1-01      cacacaaatgtttcatgtgtaacctcgaaatcaagaactttgttgagaac
A0A8C7LPD4_MCL1-01      cacg----------------acgttaggagtgaa------tgtcgtgaaa
A0A8C7PM33_MCL1-03      cacg----------------aagttaggagtgaa------tgtcgtgaaa
A0A8C7PM33_MCL1-01      cacg----------------aagttaggagtgaa------tgtcgtgaaa
A0A8C7PM33_MCL1-02      cacg----------------aagttaggagtgaa------tgtcgtgaaa
                        ***                 *   * * * * **      *** * *** 

A0A8K9V051_MCL1-01      gacaccctgctaggtgagcacatctttcacgtgtacaacacaagcggacg
A0A8C7LPD4_MCL1-01      agcaacgtcctcgataatcatttgtcagaccgaagcaaca-atgacga--
A0A8C7PM33_MCL1-03      agcaacgtcctgggtaatcatttgtcagaccgaagcaaca-atgacgact
A0A8C7PM33_MCL1-01      agcaacgtcctgggtaatcatttgtcagaccgaagcaaca-atgacgact
A0A8C7PM33_MCL1-02      agcaacgtcctgggtaatcatttgtcagaccgaagcaaca-atgacgact
                          ** * * ** * * * **  * *   **     ***** * *  **  

A0A8K9V051_MCL1-01      ctgtaagtaccttaccgataggtacacgaatcgagaagacgagatgatgc
A0A8C7LPD4_MCL1-01      -------ttctttgcc----------------------------ctgcac
A0A8C7PM33_MCL1-03      ctgacggttctttgcc----------------------------ctgcac
A0A8C7PM33_MCL1-01      ctgacggttctttgcc----------------------------ctgcac
A0A8C7PM33_MCL1-02      ctgacggttctttgcc----------------------------ctgcac
                               * * ** **                                 *

A0A8K9V051_MCL1-01      tcttactggggaaggaacggtacaggaggggaaagattgcattccctgat
A0A8C7LPD4_MCL1-01      tcct------------------cagatggcgtcagaatgtgggcctgaac
A0A8C7PM33_MCL1-03      tcct------------------caggtggcgtcagaatgtgggcctgaac
A0A8C7PM33_MCL1-01      tcct------------------caggtggcgtcagaatgtgggcctgaac
A0A8C7PM33_MCL1-02      tcct------------------caggtggcgtcagaatgtgggcctgaac
                        ** *                  ***  ** *  *** **    **   * 

A0A8K9V051_MCL1-01      agcatcatcaccaactcgac--cggagccctggacaccgacaccaggcaa
A0A8C7LPD4_MCL1-01      tatcgaattgtccatcgggcgatgaagtattggaacatgatatcagacaa
A0A8C7PM33_MCL1-03      tatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaa
A0A8C7PM33_MCL1-01      tatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaa
A0A8C7PM33_MCL1-02      tatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaa
                              **   * *   * *   * **   ****    ** *  ** ***

A0A8K9V051_MCL1-01      ctcattaaatgtgtcctaggacaatgtacgggacttctgaaacctaggtg
A0A8C7LPD4_MCL1-01      ctcattgagaattttttgggggactacacaggactgtctcagcctcgatg
A0A8C7PM33_MCL1-03      ctaattgaaaacgtattggtggactatacaggactgtctccgtctcgttg
A0A8C7PM33_MCL1-01      ctaattgaaaacgtattggtggactatacaggactgtctccgtctcgttg
A0A8C7PM33_MCL1-02      ctaattgaaaacgtattggtggactatacaggactgtctccgtctcgttg
                        ** *** *     *  * *   * *  ** *****        ** * **

A0A8K9V051_MCL1-01      gaacgaaagcaaagctctgtcaacaatgagtagagttatcgggcagttac
A0A8C7LPD4_MCL1-01      gaagcaaagcaagcctcttacgaccatgaagcgagtggtggaggacgtaa
A0A8C7PM33_MCL1-03      taagcaaagcaaggctcttacgacgatgaagaaagtggtgaaggatataa
A0A8C7PM33_MCL1-01      taagcaaagcaaggctcttacgacgatgaagaaagtggtgaaggatataa
A0A8C7PM33_MCL1-02      taagcaaagcaaggctcttacgacgatgaagaaagtggtgaaggatataa
                         **  *******  ****  * ** ****    ***  *   * *  ** 

A0A8K9V051_MCL1-01      tagagaagcacagatacacatacaacggtatgatcaacacactctatgtg
A0A8C7LPD4_MCL1-01      tagcaaagcaccgatatgcatacaagggtatggtcgtcaaacttgacctg
A0A8C7PM33_MCL1-03      tagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgactta
A0A8C7PM33_MCL1-01      tagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgactta
A0A8C7PM33_MCL1-02      tagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgactta
                        ***  ****** ****  ******* ****** **  ** ***  *  * 

A0A8K9V051_MCL1-01      gatgacagaggggataacgtgaagttcctcagtgcagtagcccatagcat
A0A8C7LPD4_MCL1-01      gatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccat
A0A8C7PM33_MCL1-03      gatgaccgatgcgatgacatgagtttcatcaattctgtggccacgaccat
A0A8C7PM33_MCL1-01      gatgaccgatgcgatgacatgagtttcatcaattctgtggccacgaccat
A0A8C7PM33_MCL1-02      gatgaccgatgcgatgacatgagtttcatcaattctgtggccacgaccat
                        *****  ** * *** ** ***   ** *** * * ** ***   * ***

A0A8K9V051_MCL1-01      ctttgaagacgggaccgtcaactggggccgtgttgccagcctgacatctt
A0A8C7LPD4_MCL1-01      gttcagtgatgggatcacgaactggggtcgcatcgccagcctggtggcat
A0A8C7PM33_MCL1-03      gttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcat
A0A8C7PM33_MCL1-01      gttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcat
A0A8C7PM33_MCL1-02      gttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcat
                         **    ** **** *   ******** **  * *********    * *

A0A8K9V051_MCL1-01      ttggggctgcggtgtgccggtacttgagaggcaaggggagagacaactgt
A0A8C7LPD4_MCL1-01      ttggcgcagtggtgagccagcacctgaaggagagtggcaggggacactgc
A0A8C7PM33_MCL1-03      ttggagcagtggtgagccagcacttgaaggagatgggcaggggacactgc
A0A8C7PM33_MCL1-01      ttggagcagtggtgagccagcacttgaaggagatgggcaggggacactgc
A0A8C7PM33_MCL1-02      ttggagcagtggtgagccagcacttgaaggagatgggcaggggacactgc
                        **** ** * **** *** * ** ***  *  *  ** ** *   **** 

A0A8K9V051_MCL1-01      gtggatttggtgggagaggagatatcagagtacctggtcactcaccacaa
A0A8C7LPD4_MCL1-01      gttgatttggtgggccaagagattgccacatacctcctctctgaccaaag
A0A8C7PM33_MCL1-03      attgagtcggtgggccaaaagatcgccacatacctcctctctgaccaaag
A0A8C7PM33_MCL1-01      attgagtcggtgggccaaaagatcgccacatacctcctctctgaccaaag
A0A8C7PM33_MCL1-02      attgagtcggtgggccaaaagatcgccacatacctcctctctgaccaaag
                         * ** * ******  *  ****  *    *****  ** ** **** * 

A0A8K9V051_MCL1-01      ggactggctagtcaaacataactcctggaatgggttcgtggagttctttc
A0A8C7LPD4_MCL1-01      ggactggctggtcaaaaacaatgcttgggatggatttgtagagttctttc
A0A8C7PM33_MCL1-03      ggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttc
A0A8C7PM33_MCL1-01      ggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttc
A0A8C7PM33_MCL1-02      ggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttc
                        ********* ****** * **  * *** **** ** ** **********

A0A8K9V051_MCL1-01      cagtagcagaacctgagtccagatgtcggaac---atcatcatgaccatt
A0A8C7LPD4_MCL1-01      atgttcaagatcctgagtcctcgaaaatggactatgcccgcaagttctct
A0A8C7PM33_MCL1-03      atgtgcaagatccagagtcctcagtaaggaac---accctcatagccttt
A0A8C7PM33_MCL1-01      atgtgcaagatccagagtcctcagtaaggaac---accctcatagccttt
A0A8C7PM33_MCL1-02      atgtgcaagatccagagtcctcagtaaggaac---accctcatagccttt
                          **   *** ** ******        * **     *  **    *  *

A0A8K9V051_MCL1-01      tttggattggctggtattggggcaacaatgaccttcttggttat------
A0A8C7LPD4_MCL1-01      gaaatccttgacag---------------caccatggttg----------
A0A8C7PM33_MCL1-03      gctggatttgctgggcttggggcaacactcgccatgttggtcagtctgtt
A0A8C7PM33_MCL1-01      gctggatttgctgggcttggggcaacactcgccatgttggtcag------
A0A8C7PM33_MCL1-02      gctggatttgctgggcttggggcaacactcgccatgttggtcag------
                               * *   *                 ** *  * *          

A0A8K9V051_MCL1-01      ------------------g-------------------------------
A0A8C7LPD4_MCL1-01      ------------------gaatgagtacccag------------------
A0A8C7PM33_MCL1-03      ggattatagtggcggactgaattgggacagtgctttggtgtcaagctcaa
A0A8C7PM33_MCL1-01      ------------------gaattcaga---------------------ag
A0A8C7PM33_MCL1-02      ------------------g-------------------------------
                                          *                               

A0A8K9V051_MCL1-01      --tga
A0A8C7LPD4_MCL1-01      --tga
A0A8C7PM33_MCL1-03      gttag
A0A8C7PM33_MCL1-01      attag
A0A8C7PM33_MCL1-02      --tga
                          *  

© 1998-2023Legal notice