Dataset for CDS MCL-1 of organism Oncorhynchus mykiss

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C7PM33_MCL1-03      atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattt
A0A8C7PM33_MCL1-01      atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattt
A0A8C7PM33_MCL1-02      atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattt
                        **************************************************

A0A8C7PM33_MCL1-03      tcaaaatggagtcgttggaggctcttcgtaccctgctggtacctctttgt
A0A8C7PM33_MCL1-01      tcaaaatggagtcgttggaggctcttcgtaccctgctggtacctctttgt
A0A8C7PM33_MCL1-02      tcaaaatggagtcgttggaggctcttcgtaccctgctggtacctctttgt
                        **************************************************

A0A8C7PM33_MCL1-03      actatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtca
A0A8C7PM33_MCL1-01      actatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtca
A0A8C7PM33_MCL1-02      actatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtca
                        **************************************************

A0A8C7PM33_MCL1-03      aaagtggatactgacttgggtaatgggactggcgacactccaccacgacc
A0A8C7PM33_MCL1-01      aaagtggatactgacttgggtaatgggactggcgacactccaccacgacc
A0A8C7PM33_MCL1-02      aaagtggatactgacttgggtaatgggactggcgacactccaccacgacc
                        **************************************************

A0A8C7PM33_MCL1-03      cacgaagttaggagtgaatgtcgtgaaaagcaacgtcctgggtaatcatt
A0A8C7PM33_MCL1-01      cacgaagttaggagtgaatgtcgtgaaaagcaacgtcctgggtaatcatt
A0A8C7PM33_MCL1-02      cacgaagttaggagtgaatgtcgtgaaaagcaacgtcctgggtaatcatt
                        **************************************************

A0A8C7PM33_MCL1-03      tgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcact
A0A8C7PM33_MCL1-01      tgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcact
A0A8C7PM33_MCL1-02      tgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcact
                        **************************************************

A0A8C7PM33_MCL1-03      cctcaggtggcgtcagaatgtgggcctgaactatcgaattgtcaatcggg
A0A8C7PM33_MCL1-01      cctcaggtggcgtcagaatgtgggcctgaactatcgaattgtcaatcggg
A0A8C7PM33_MCL1-02      cctcaggtggcgtcagaatgtgggcctgaactatcgaattgtcaatcggg
                        **************************************************

A0A8C7PM33_MCL1-03      cgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
A0A8C7PM33_MCL1-01      cgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
A0A8C7PM33_MCL1-02      cgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
                        **************************************************

A0A8C7PM33_MCL1-03      tggactatacaggactgtctccgtctcgttgtaagcaaagcaaggctctt
A0A8C7PM33_MCL1-01      tggactatacaggactgtctccgtctcgttgtaagcaaagcaaggctctt
A0A8C7PM33_MCL1-02      tggactatacaggactgtctccgtctcgttgtaagcaaagcaaggctctt
                        **************************************************

A0A8C7PM33_MCL1-03      acgacgatgaagaaagtggtgaaggatataatagcaaagcaccgatacgc
A0A8C7PM33_MCL1-01      acgacgatgaagaaagtggtgaaggatataatagcaaagcaccgatacgc
A0A8C7PM33_MCL1-02      acgacgatgaagaaagtggtgaaggatataatagcaaagcaccgatacgc
                        **************************************************

A0A8C7PM33_MCL1-03      atacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgaca
A0A8C7PM33_MCL1-01      atacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgaca
A0A8C7PM33_MCL1-02      atacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgaca
                        **************************************************

A0A8C7PM33_MCL1-03      tgagtttcatcaattctgtggccacgaccatgttcagtgatgggaccacg
A0A8C7PM33_MCL1-01      tgagtttcatcaattctgtggccacgaccatgttcagtgatgggaccacg
A0A8C7PM33_MCL1-02      tgagtttcatcaattctgtggccacgaccatgttcagtgatgggaccacg
                        **************************************************

A0A8C7PM33_MCL1-03      aactggggtcgcatcgccagcctggtggcatttggagcagtggtgagcca
A0A8C7PM33_MCL1-01      aactggggtcgcatcgccagcctggtggcatttggagcagtggtgagcca
A0A8C7PM33_MCL1-02      aactggggtcgcatcgccagcctggtggcatttggagcagtggtgagcca
                        **************************************************

A0A8C7PM33_MCL1-03      gcacttgaaggagatgggcaggggacactgcattgagtcggtgggccaaa
A0A8C7PM33_MCL1-01      gcacttgaaggagatgggcaggggacactgcattgagtcggtgggccaaa
A0A8C7PM33_MCL1-02      gcacttgaaggagatgggcaggggacactgcattgagtcggtgggccaaa
                        **************************************************

A0A8C7PM33_MCL1-03      agatcgccacatacctcctctctgaccaaagggactggctggtcaaaaac
A0A8C7PM33_MCL1-01      agatcgccacatacctcctctctgaccaaagggactggctggtcaaaaac
A0A8C7PM33_MCL1-02      agatcgccacatacctcctctctgaccaaagggactggctggtcaaaaac
                        **************************************************

A0A8C7PM33_MCL1-03      aatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
A0A8C7PM33_MCL1-01      aatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
A0A8C7PM33_MCL1-02      aatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
                        **************************************************

A0A8C7PM33_MCL1-03      ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttgggg
A0A8C7PM33_MCL1-01      ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttgggg
A0A8C7PM33_MCL1-02      ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttgggg
                        **************************************************

A0A8C7PM33_MCL1-03      caacactcgccatgttggtcagtctgttggattatagtggcggactgaat
A0A8C7PM33_MCL1-01      caacactcgccatgttggtcag------------------------gaat
A0A8C7PM33_MCL1-02      caacactcgccatgttggtcag------------------------g---
                        **********************                        *   

A0A8C7PM33_MCL1-03      tgggacagtgctttggtgtcaagctcaagttag
A0A8C7PM33_MCL1-01      tcaga---------------------agattag
A0A8C7PM33_MCL1-02      ------------------------------tga
                                                      *  

© 1998-2022Legal notice