Dataset for CDS BCL-2-like of organism Podarcis muralis

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A670IB81_BCL2-01      atg---------------------atggctcagactgggata--------
A0A670JXJ0_BCL2A1-      atg---------------------gag----a-gccgagg----------
A0A670JXJ0_BCL2A1-      atg---------------------aaa----aggctgaagtcactaagtt
A0A670JXJ0_BCL2A1-      atg---------------------aaa----aggctgaagtcactaagtt
A0A670IBZ4_BCL2L1-      atgtcacgcaataacagggcgctcgtggtagactttg-------------
A0A670K3Y6_MCL1-01      atgtt---taacaagaagtcggtggtgttgtattgtgggggcgcaccgag
                        ***                            *    *             

A0A670IB81_BCL2-01      -----------------------------------------agag-----
A0A670JXJ0_BCL2A1-      -----------------------------------------ggag-----
A0A670JXJ0_BCL2A1-      cagctctcaagcaacctgcaaatcatttgaacctgcattgtggag-----
A0A670JXJ0_BCL2A1-      cagctctcaagcaacctgcaaatcatttgaacctgcattgtggag-----
A0A670IBZ4_BCL2L1-      ---------------------tttcctacaagctgtcagagaggg-----
A0A670K3Y6_MCL1-01      catggcgcccgccacgccggtctccccgggggccggcggaggcggcagca
                                                                    *     

A0A670IB81_BCL2-01      -----------------gttacgac-------------------------
A0A670JXJ0_BCL2A1-      -----------------ggcgcagcc------------------------
A0A670JXJ0_BCL2A1-      -----------------gtcacagcttgcatt-------ttgccctctgt
A0A670JXJ0_BCL2A1-      -----------------gtcacagcttgcatt-------ttgccctctgt
A0A670IBZ4_BCL2L1-      -----------------gccacagctgggatg------------------
A0A670K3Y6_MCL1-01      gtagtggagccccaaccgcctcagccgcggcggccgccgtcttcaccgcc
                                         *   *  *                         

A0A670IB81_BCL2-01      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------gtct--------------
A0A670JXJ0_BCL2A1-      gctcatttctcaatggaaaacaaccagttgcagtctgttgacactttggt
A0A670JXJ0_BCL2A1-      gctcatttctcaatggaaaacaaccagttgcagtctgttgacactttggt
A0A670IBZ4_BCL2L1-      ---agctg----gaggaggacagcgagaacaggact--------------
A0A670K3Y6_MCL1-01      aacggccgctctgagggcgccggcccgttctcgcct--------------
                                                                          

A0A670IB81_BCL2-01      --------acaagagagatagtgcagacgtacatccattacaagctgtc-
A0A670JXJ0_BCL2A1-      ------ccgccggcgacatg-----------gccgccctgcacgccgcc-
A0A670JXJ0_BCL2A1-      ccaagactacttgaaacatgtttgtgaggatgccgaactggacgctgccc
A0A670JXJ0_BCL2A1-      ccaagactacttgaaacatgtttgtgaggatgccgaactggacgctgccc
A0A670IBZ4_BCL2L1-      --gagtt---gagagacgagatggacagcgtccccaatgggagtccgtc-
A0A670K3Y6_MCL1-01      --cggattgggcgcggctggggggccagcgtcttccctgaggggccctt-
                                    *                               *     

A0A670IB81_BCL2-01      ----------------------------------------gcagaaggga
A0A670JXJ0_BCL2A1-      --------------------------------------------aaggga
A0A670JXJ0_BCL2A1-      cgagtcgagttgcccaagtcttggcaagagtagcaccttcgcttcaggaa
A0A670JXJ0_BCL2A1-      cgagtcgagttgcccaagtcttggcaagagtagcaccttcgcttcaggaa
A0A670IBZ4_BCL2L1-      -------------------------------------ttggcatcaaagt
A0A670K3Y6_MCL1-01      -----------------------------gccgcggattggctcaggggc
                                                                          

A0A670IB81_BCL2-01      tat---gactgggttgccagtgaagacagagaagaccttccttct-----
A0A670JXJ0_BCL2A1-      ----------gcgctgcgagcggagctgaag---------c---------
A0A670JXJ0_BCL2A1-      ----------gaagtggaagagaagataaag---------ccact-----
A0A670JXJ0_BCL2A1-      ----------gaagtggaagagaagataaag---------ccact-----
A0A670IBZ4_BCL2L1-      acc---------agcccggtcgtaaatgggg---------ctactggaca
A0A670K3Y6_MCL1-01      gcccctggcggggcccctggcgcggattggg---------cccttcgaag
                                             *        *         *         

A0A670IB81_BCL2-01      ------cctcctcttcctccagatcc-tcctgctgcagagaccttcccta
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      ------ttggcactccatcaagatcagttctgtcgaggaggccagtgaca
A0A670JXJ0_BCL2A1-      ------ttggcactccatcaagatcagttctgtcgaggaggccagtgaca
A0A670IBZ4_BCL2L1-      ------cccgagcat-----------------cctcagtgatc-ttgaag
A0A670K3Y6_MCL1-01      tagcgccccgcgcgctgattggctcc--cccgccgcggcggccgttggcg
                                                                          

A0A670IB81_BCL2-01      accttgc---------------------------------taggctggca
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      ttttcag---------------------------------ccaggtgatg
A0A670JXJ0_BCL2A1-      ttttcag---------------------------------ccaggtgatg
A0A670IBZ4_BCL2L1-      acagccc---------------------------------aaggttggac
A0A670K3Y6_MCL1-01      gcggcgccgcgcggccgttggcgctggcgctccctgagggagagctggac
                                                                          

A0A670IB81_BCL2-01      tctcatccttccgagctgcctgtaagtaacgtcgccccggctggcg----
A0A670JXJ0_BCL2A1-      --------------gccgcctggga--------gccctgagcg-------
A0A670JXJ0_BCL2A1-      gctcaggaattt--gccgac-ggga--------acaccaactggggacgg
A0A670JXJ0_BCL2A1-      gctcaggaattt--gccgac-ggga--------acaccaactggggacgg
A0A670IBZ4_BCL2L1-      g----------tga---ggcagacgctaag------------agaggc--
A0A670K3Y6_MCL1-01      ggctgcgacgacga---ggccgaggcccaggccgcccaggccggagacct
                                         * * *                            

A0A670IB81_BCL2-01      -----gaccgcaccctgtgccacagg--ttgtccacgcgactttacgtca
A0A670JXJ0_BCL2A1-      -------------------------------ccgccgagaagctgcgcca
A0A670JXJ0_BCL2A1-      attttgacaatattcgtcttcgcaggaattatcgcaaagaagttgcgaca
A0A670JXJ0_BCL2A1-      attttgacaatattcgtcttcgcaggaattatcgcaaagaagttgcgaca
A0A670IBZ4_BCL2L1-      ------------------------------------------aggcgatg
A0A670K3Y6_MCL1-01      gccttcgcccaccccttcgctggagtccatcccgtccgcgcagggcgacg
                                                                     **   

A0A670IB81_BCL2-01      agccggggat--------------------------gagttttcgcggcg
A0A670JXJ0_BCL2A1-      g--------------------------------------tcgcggct---
A0A670JXJ0_BCL2A1-      gcacggagttcctttgacaagagaaaacgtggaaccgatttgccactgtg
A0A670JXJ0_BCL2A1-      gcacggagttcctttgacaagagaaaacgtggaaccgatttgccactgtg
A0A670IBZ4_BCL2L1-      a-------------------------------------------------
A0A670K3Y6_MCL1-01      acg---------------------------------acgacgcggcggtg
                                                                          

A0A670IB81_BCL2-01      ttacagga-------------------------------------gggac
A0A670JXJ0_BCL2A1-      ---------------------------cgtg-------------cgcggc
A0A670JXJ0_BCL2A1-      tcactgaatttataaacaccaaagctacgtggatcagcgaaaatggaggc
A0A670JXJ0_BCL2A1-      tcactgaatttataaacaccaaagctacgtggatcagcgaaaatggaggc
A0A670IBZ4_BCL2L1-      --gtttgaactg--------------------------------------
A0A670K3Y6_MCL1-01      acgctggagttggtgagccggtacctgcgcgaggaggccgccgcctcgcc
                                                                          

A0A670IB81_BCL2-01      t----------t-------------------tgc--------tcagatgt
A0A670JXJ0_BCL2A1-      a----------aggtgttggagcatcctaaatac--------caagcttc
A0A670JXJ0_BCL2A1-      t----------gggtgttggagcatcctaaatac--------caagcttc
A0A670JXJ0_BCL2A1-      t----------g--------------------------------------
A0A670IBZ4_BCL2L1-      -----------aggtaccggagagctttcagtgacc------tcacatcc
A0A670K3Y6_MCL1-01      gggcgccgcgcaggcgctggagaccctccggcgggtcggggacaacatcc
                                                                          

A0A670IB81_BCL2-01      ctggacagctgcac----ttgacc---------ccggtcactgccaga--
A0A670JXJ0_BCL2A1-      tcagagaattgcag----tcttcctaagcatgtcggatgaggtccagaca
A0A670JXJ0_BCL2A1-      tcagagaattgcag----tcttcctaagcatgtcggatgaggtccagaca
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      cagctccacatcacc---cctggcacagcat-------------------
A0A670K3Y6_MCL1-01      tcgacaagcaccagctggctttccaaggaatgcttaggaaaattgaaata
                                                                          

A0A670IB81_BCL2-01      -----------------gctcgctttgcggcagttgtcgaagagctcttc
A0A670JXJ0_BCL2A1-      gaagaaatcattaa---ggacattttccagca--tggcaaagagtgcttc
A0A670JXJ0_BCL2A1-      gaagaaatcattaa---ggacattttccagca--tggcaaagagtgcttc
A0A670JXJ0_BCL2A1-      -----------------ggacagcttcc----------------------
A0A670IBZ4_BCL2L1-      -------------accagagctttgagc---aggtggtgaatgaactttt
A0A670K3Y6_MCL1-01      aagaaagaggatgacctgaagactgtgtcagaagttgcaaagcacctttt
                                         *                                

A0A670IB81_BCL2-01      -----------cga-------------------gacggggt---gaa---
A0A670JXJ0_BCL2A1-      attccgcattacaagccccggagcagccacatggacatggt---gaagct
A0A670JXJ0_BCL2A1-      attccgcattacaagccccggagcagccacatggacatggt---gaagct
A0A670JXJ0_BCL2A1-      --------ttgcaa------------------------------------
A0A670IBZ4_BCL2L1-      -----------------------------ccgggacggggt---gaa---
A0A670K3Y6_MCL1-01      -----------------------------cagtgacggcataacaaa---
                                                                          

A0A670IB81_BCL2-01      ------ctgggggaggattgtggcgttctt--------------------
A0A670JXJ0_BCL2A1-      agcttcctacgaagaaattgctttgctccccttgacttcctggaacatcc
A0A670JXJ0_BCL2A1-      agcttcctacgaagaaattgctttgctccccttgacttcctggaacatcc
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      ------ctgggggaggattgtggcatttttc----------------tcc
A0A670K3Y6_MCL1-01      ------ctggggtcgaattgtgactctcatc----------------tct
                                                                          

A0A670IB81_BCL2-01      -tgagttcggtgg-catgatgtgcgtggagag----cgtcagccgggaga
A0A670JXJ0_BCL2A1-      atcagccggctgaaaatgacatcagggaagaagccttgtcagcggcagag
A0A670JXJ0_BCL2A1-      atcagccggctgaaaatgacatcagggaagaagccttgtcagcggcagag
A0A670JXJ0_BCL2A1-      ---agttgggtga----------agagaagagtccctggc----------
A0A670IBZ4_BCL2L1-      ttcgg------aggggccctgtgcgtggagag----cgtcgacaaggaga
A0A670K3Y6_MCL1-01      tttggtgcctttgttgccaaacatctgaagcg----catcaatcaggaga
                            *                     * **         *          

A0A670IB81_BCL2-01      -tgtcgccccttgtggacaatatcacagtgtggatgactgac--tacctg
A0A670JXJ0_BCL2A1-      -ggtc--------tggatctcatcctcgtgccaggacttggttttgacca
A0A670JXJ0_BCL2A1-      -ggtc--------tggatctcatcctcgtgccaggacttggttttgacca
A0A670JXJ0_BCL2A1-      --------------------------------------tggccttg----
A0A670IBZ4_BCL2L1-      -tgcgagtgctggtgggacggattgtcagctggatgaccactta---cct
A0A670K3Y6_MCL1-01      gtgccatcggtcgtttggcaga----------gctcatcactgaggttct
                                                                          

A0A670IB81_BCL2-01      a---acgggc-acctggacaactggatccaagacaatggaggctgggatg
A0A670JXJ0_BCL2A1-      a---accggc-a-----acagactgggaagaggaaaggggtactatgata
A0A670JXJ0_BCL2A1-      a---accggc-a-----acagactgggaagaggaaaggggtactatgata
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      g---acggaccacctggacccgtggatccaagaaaatggcggctgggaga
A0A670K3Y6_MCL1-01      ggttacagacaagcggga---atggatcctcaacaataatgcctgggagg
                                                                          

A0A670IB81_BCL2-01      cttttgtgga---gctctacagcaacaacat-----------gaggcctt
A0A670JXJ0_BCL2A1-      catacctgaa---caggtgcag--acagcat----cccaaaggaaaacct
A0A670JXJ0_BCL2A1-      catacctgaa---caggtgcag--acagcat----cccaaaggaaaacct
A0A670JXJ0_BCL2A1-      -------------------------cactac----atcaagacaaaac--
A0A670IBZ4_BCL2L1-      ggtttgtgga---cctctacgggaacgacgccgcagccaagagcaggaaa
A0A670K3Y6_MCL1-01      gatttgttaatttcttccatgtagaggacgt----------agaaggcag
                                                                          

A0A670IB81_BCL2-01      tgttcgatttctcgtgg----ctgcctctgaagacaa-------------
A0A670JXJ0_BCL2A1-      tacacaa----tcgcct----tggcttttaaagaacaagtgtgtgacgtg
A0A670JXJ0_BCL2A1-      tacacaa----tcgcct----tggcttttaaagaacaagtgtgtgacgtg
A0A670JXJ0_BCL2A1-      -----------tcatct----ccgctttc-------------------tc
A0A670IBZ4_BCL2L1-      ggccaggaacgcttcaacaagtggctgtggacg--------------ggg
A0A670K3Y6_MCL1-01      catcagaagcgttctga----tggcttttgcag--------------g--
                                               **                         

A0A670IB81_BCL2-01      --ttctgagtctg-----gctgttgtgggtgcctgcatcacccttggagc
A0A670JXJ0_BCL2A1-      gtccctgcgtctgaaaatgatgtgaaagttgatgaaatcctgtttgaag-
A0A670JXJ0_BCL2A1-      gtccctgcgtctgaaaatgatgtgaaagttgatgaaatcctgtttgaag-
A0A670JXJ0_BCL2A1-      gttcttcagtc-----------------------------------aat-
A0A670IBZ4_BCL2L1-      gccaccgtggccg----------------gggtcg--tcctcctcggctc
A0A670K3Y6_MCL1-01      -----cgtggctg----------------gaataggagcaggtttggctt
                                * *                                       

A0A670IB81_BCL2-01      ttatctggggcataagtga
A0A670JXJ0_BCL2A1-      -----------acaactga
A0A670JXJ0_BCL2A1-      -----------acaactga
A0A670JXJ0_BCL2A1-      -----------attactga
A0A670IBZ4_BCL2L1-      cctcctgagccgcaaatag
A0A670K3Y6_MCL1-01      a--catgatccggtga---
                                           

© 1998-2020Legal notice