Dataset for CDS BCL-2-like of organism Podarcis muralis

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A670IB81_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Podarcis muralis GN=BCL-2 (length=699 residues).
atgatggctcagactgggataagaggttacgacacaagagagatagtgcagacgtacatccattacaagctgtcgcagaa
gggatatgactgggttgccagtgaagacagagaagaccttccttctcctcctcttcctccagatcctcctgctgcagaga
ccttccctaaccttgctaggctggcatctcatccttccgagctgcctgtaagtaacgtcgccccggctggcggaccgcac
cctgtgccacaggttgtccacgcgactttacgtcaagccggggatgagttttcgcggcgttacaggagggactttgctca
gatgtctggacagctgcacttgaccccggtcactgccagagctcgctttgcggcagttgtcgaagagctcttccgagacg
gggtgaactgggggaggattgtggcgttctttgagttcggtggcatgatgtgcgtggagagcgtcagccgggagatgtcg
ccccttgtggacaatatcacagtgtggatgactgactacctgaacgggcacctggacaactggatccaagacaatggagg
ctgggatgcttttgtggagctctacagcaacaacatgaggcctttgttcgatttctcgtggctgcctctgaagacaattc
tgagtctggctgttgtgggtgcctgcatcacccttggagcttatctggggcataagtga
>gnl|bcl2dbcds|A0A670IBZ4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Podarcis muralis GN=BCL2L1 (length=684 residues).
atgtcacgcaataacagggcgctcgtggtagactttgtttcctacaagctgtcagagaggggccacagctgggatgagct
ggaggaggacagcgagaacaggactgagttgagagacgagatggacagcgtccccaatgggagtccgtcttggcatcaaa
gtaccagcccggtcgtaaatggggctactggacacccgagcatcctcagtgatcttgaagacagcccaaggttggacgtg
aggcagacgctaagagaggcaggcgatgagtttgaactgaggtaccggagagctttcagtgacctcacatcccagctcca
catcacccctggcacagcataccagagctttgagcaggtggtgaatgaacttttccgggacggggtgaactgggggagga
ttgtggcatttttctccttcggaggggccctgtgcgtggagagcgtcgacaaggagatgcgagtgctggtgggacggatt
gtcagctggatgaccacttacctgacggaccacctggacccgtggatccaagaaaatggcggctgggagaggtttgtgga
cctctacgggaacgacgccgcagccaagagcaggaaaggccaggaacgcttcaacaagtggctgtggacgggggccaccg
tggccggggtcgtcctcctcggctccctcctgagccgcaaatag
>gnl|bcl2dbcds|A0A670JXJ0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Podarcis muralis GN=BCL2A1 (length=1014 residues).
atgaaaaggctgaagtcactaagttcagctctcaagcaacctgcaaatcatttgaacctgcattgtggaggtcacagctt
gcattttgccctctgtgctcatttctcaatggaaaacaaccagttgcagtctgttgacactttggtccaagactacttga
aacatgtttgtgaggatgccgaactggacgctgccccgagtcgagttgcccaagtcttggcaagagtagcaccttcgctt
caggaagaagtggaagagaagataaagccactttggcactccatcaagatcagttctgtcgaggaggccagtgacatttt
cagccaggtgatggctcaggaatttgccgacgggaacaccaactggggacggattttgacaatattcgtcttcgcaggaa
ttatcgcaaagaagttgcgacagcacggagttcctttgacaagagaaaacgtggaaccgatttgccactgtgtcactgaa
tttataaacaccaaagctacgtggatcagcgaaaatggaggctgggtgttggagcatcctaaataccaagcttctcagag
aattgcagtcttcctaagcatgtcggatgaggtccagacagaagaaatcattaaggacattttccagcatggcaaagagt
gcttcattccgcattacaagccccggagcagccacatggacatggtgaagctagcttcctacgaagaaattgctttgctc
cccttgacttcctggaacatccatcagccggctgaaaatgacatcagggaagaagccttgtcagcggcagagggtctgga
tctcatcctcgtgccaggacttggttttgaccaaaccggcaacagactgggaagaggaaaggggtactatgatacatacc
tgaacaggtgcagacagcatcccaaaggaaaaccttacacaatcgccttggcttttaaagaacaagtgtgtgacgtggtc
cctgcgtctgaaaatgatgtgaaagttgatgaaatcctgtttgaagacaactga
>gnl|bcl2dbcds|A0A670JXJ0_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Podarcis muralis GN=BCL2A1 (length=633 residues).
atgaaaaggctgaagtcactaagttcagctctcaagcaacctgcaaatcatttgaacctgcattgtggaggtcacagctt
gcattttgccctctgtgctcatttctcaatggaaaacaaccagttgcagtctgttgacactttggtccaagactacttga
aacatgtttgtgaggatgccgaactggacgctgccccgagtcgagttgcccaagtcttggcaagagtagcaccttcgctt
caggaagaagtggaagagaagataaagccactttggcactccatcaagatcagttctgtcgaggaggccagtgacatttt
cagccaggtgatggctcaggaatttgccgacgggaacaccaactggggacggattttgacaatattcgtcttcgcaggaa
ttatcgcaaagaagttgcgacagcacggagttcctttgacaagagaaaacgtggaaccgatttgccactgtgtcactgaa
tttataaacaccaaagctacgtggatcagcgaaaatggaggctgggacagcttccttgcaaagttgggtgaagagaagag
tccctggctggccttgcactacatcaagacaaaactcatctccgctttctcgttcttcagtcaatattactga
>gnl|bcl2dbcds|A0A670JXJ0_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Podarcis muralis GN=BCL2A1 (length=642 residues).
atggagagccgaggggagggcgcagccgtctccgccggcgacatggccgccctgcacgccgccaagggagcgctgcgagc
ggagctgaagcgccgcctgggagccctgagcgccgccgagaagctgcgccagtcgcggctcgtgcgcggcaaggtgttgg
agcatcctaaataccaagcttctcagagaattgcagtcttcctaagcatgtcggatgaggtccagacagaagaaatcatt
aaggacattttccagcatggcaaagagtgcttcattccgcattacaagccccggagcagccacatggacatggtgaagct
agcttcctacgaagaaattgctttgctccccttgacttcctggaacatccatcagccggctgaaaatgacatcagggaag
aagccttgtcagcggcagagggtctggatctcatcctcgtgccaggacttggttttgaccaaaccggcaacagactggga
agaggaaaggggtactatgatacatacctgaacaggtgcagacagcatcccaaaggaaaaccttacacaatcgccttggc
ttttaaagaacaagtgtgtgacgtggtccctgcgtctgaaaatgatgtgaaagttgatgaaatcctgtttgaagacaact
ga
>gnl|bcl2dbcds|A0A670K3Y6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Podarcis muralis GN=MCL-1 (length=996 residues).
atgtttaacaagaagtcggtggtgttgtattgtgggggcgcaccgagcatggcgcccgccacgccggtctccccgggggc
cggcggaggcggcagcagtagtggagccccaaccgcctcagccgcggcggccgccgtcttcaccgccaacggccgctctg
agggcgccggcccgttctcgcctcggattgggcgcggctggggggccagcgtcttccctgaggggcccttgccgcggatt
ggctcaggggcgcccctggcggggcccctggcgcggattgggcccttcgaagtagcgccccgcgcgctgattggctcccc
cgccgcggcggccgttggcggcggcgccgcgcggccgttggcgctggcgctccctgagggagagctggacggctgcgacg
acgaggccgaggcccaggccgcccaggccggagacctgccttcgcccaccccttcgctggagtccatcccgtccgcgcag
ggcgacgacgacgacgcggcggtgacgctggagttggtgagccggtacctgcgcgaggaggccgccgcctcgccgggcgc
cgcgcaggcgctggagaccctccggcgggtcggggacaacatcctcgacaagcaccagctggctttccaaggaatgctta
ggaaaattgaaataaagaaagaggatgacctgaagactgtgtcagaagttgcaaagcaccttttcagtgacggcataaca
aactggggtcgaattgtgactctcatctcttttggtgcctttgttgccaaacatctgaagcgcatcaatcaggagagtgc
catcggtcgtttggcagagctcatcactgaggttctggttacagacaagcgggaatggatcctcaacaataatgcctggg
agggatttgttaatttcttccatgtagaggacgtagaaggcagcatcagaagcgttctgatggcttttgcaggcgtggct
ggaataggagcaggtttggcttacatgatccggtga
© 1998-2020Legal notice