Dataset for CDS BCL-2-like of organism Ficedula albicollis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

U3KEW4_BCL2-01        atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
U3JSL7_BCL2L1-01      ------------------atgtacagcagtaatcgggagttagtgattga
U3JTB2_BCL2A1-01      ------------------atggaaactgctga------------gttcta
U3KKY6_MCL1-01        -----------------aaaaaaaataaaaaa------------aatct-
                                        *            *              *   

U3KEW4_BCL2-01        gtacatccactataaactctcgcagaggggatacgactgggct-------
U3JSL7_BCL2L1-01      ctttgtttcttacaagctctcacagaaaggctacagctggagtcagctgg
U3JTB2_BCL2A1-01      ttacgtttattacttagccc------------------------------
U3KKY6_MCL1-01        -----------------ccc------------------------------

U3KEW4_BCL2-01        -----gccggcgagcacagggcacccctgcctcc-----aggtctctctg
U3JSL7_BCL2L1-01      aggaggaggatgagaacaggactgactttgcaggggaggaggacgagatg
U3JTB2_BCL2A1-01      ---------------------------------------aggattatctg
U3KKY6_MCL1-01        ---------------------------------------agga-------

U3KEW4_BCL2-01        ctcctgctgctgctgcggttgctgctgctgctgggacttcctctgatcac
U3JSL7_BCL2L1-01      gacggcgtgct----caacggaagcccctcctggcacgcacccaccagcc
U3JTB2_BCL2A1-01      cagtatgtgct----c--caggaatcacacctcggaccagccca-----g
U3KKY6_MCL1-01        ------atgct----c--cgaaaa--------------------------
                             ****    *                                  

U3KEW4_BCL2-01        actgggccggtgtctccgcaccccgagccccccggctcggctgctgctag
U3JSL7_BCL2L1-01      ac----atagtgaacggagcctccgtgcaccagagcagc----ctcgaag
U3JTB2_BCL2A1-01      ac----cagggttgcccatgtcctgcgaaccatggcatcttccctgcaag
U3KKY6_MCL1-01        -------------------------------------------ctggaaa
                                                                 **   * 

U3KEW4_BCL2-01        ccccgcgcccccggccgaggggctgcgccccgcaccccaggtcgtccacc
U3JSL7_BCL2L1-01      tccatgagatccgtcgagcagccgacgtgaggca----------------
U3JTB2_BCL2A1-01      acca--------------------aaccgagg-a----------------
U3KKY6_MCL1-01        tcca--------------------gcaagaag-a----------------
                       **                            * *                

U3KEW4_BCL2-01        tggtcctgcgccaggcgggcgacgagtt----ctcccggcgctaccagag
U3JSL7_BCL2L1-01      -ggcgctgagagaggcgggggatgagtttgagctga----ggtaccggcg
U3JTB2_BCL2A1-01      -ggctctcaggccactcctggacaggattgacatcacctcagtagctgtt
U3KKY6_MCL1-01        -ggacctgcagtcggtggtgga------------------ggtggctgc-
                       **  **             **                    *  * *  

U3KEW4_BCL2-01        ggactttgcccaaatgtctggccagctgcacctgacgcccttcacggcca
U3JSL7_BCL2L1-01      ggcgttcagcgacctcacttcccagctccacatcactcccagcacagcgt
U3JTB2_BCL2A1-01      g--------------------------ccaagaga---------------
U3KKY6_MCL1-01        ---------------------------ccacg------------------

U3KEW4_BCL2-01        ggagccgcttcgtggccgtggtggaggagctcttccgagacggggtt---
U3JSL7_BCL2L1-01      atcagagctttgagcaggtagtgaacgaactgttccgcgatggagtg---
U3JTB2_BCL2A1-01      -----attttcaatggagtcatggatgaaaagtttgctgatggaaatact
U3KKY6_MCL1-01        ------------------------------tgttcagcgatggggtgacc
                                                      **    ** **       

U3KEW4_BCL2-01        aactggggcagaatcgtggccttcttcgagtttggcggcgtgatgtg---
U3JSL7_BCL2L1-01      aactggggccgcatcgtggctttcttctccttcggaggagccttgtg---
U3JTB2_BCL2A1-01      aactggggacgaattatgaccatatttacatttggag--gtcttctcacc
U3KKY6_MCL1-01        aactggggacgtgtggtgaccctcattgcctttggag--ccttcgtggcc
                      ********  *  *  ** *  *  *    ** ** *        *    

U3KEW4_BCL2-01        ------cgtggagagcgt--------------caacagggagatgtctcc
U3JSL7_BCL2L1-01      ------cgtggagagcgt--------------tgttaaggagatgcgggt
U3JTB2_BCL2A1-01      aagaagcttcaagagcatggggttcagctgactgcagaggagaaggagg-
U3KKY6_MCL1-01        aagca-cctgaagagcat-----------------caagcaggagcaga-
                            * *  ***** *                    * **  *     

U3KEW4_BCL2-01        gctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacc
U3JSL7_BCL2L1-01      attggtgaaacgcatcgtgtcttggatgaccacgtacttgaccgaccact
U3JTB2_BCL2A1-01      -----------agatctcttatttcatcacagagtacatcatcaacaaca
U3KKY6_MCL1-01        -----------gcatcacttccc---------------------------

U3KEW4_BCL2-01        tgcacaactggatccaggacaacggaggctgggatgc------ctttgtg
U3JSL7_BCL2L1-01      tagatccctggatccaggagaatggcggatgggagcg------ctttgtg
U3JTB2_BCL2A1-01      aatccgaatggattgatgcaaatggtggctgggaaaatggcttcctaaca
U3KKY6_MCL1-01        -------------------------tggctgggatcatcac---------
                                                ** *****                

U3KEW4_BCL2-01        gagttgtatggcaacagta-tgaggcctttgttcgatttctcctggatct
U3JSL7_BCL2L1-01      gacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagac
U3JTB2_BCL2A1-01      aagtttgaaagaagat-cactactgt-----------------------c
U3KKY6_MCL1-01        ------------agatgcactggtgt-----------------------c
                                  *       *   *                         

U3KEW4_BCL2-01        ctctgaagact--------------atcctgagtctggttctggtgggag
U3JSL7_BCL2L1-01      cttcaacaaatggctcctgaccggggcgacgg---------tggccggag
U3JTB2_BCL2A1-01      cttctccaaa---------------attacagccctgttcatagctgttg
U3KKY6_MCL1-01        ctcc----aa---------------acgccag---------tggctggag
                      **      *                                * *  *  *

U3KEW4_BCL2-01        cttgcatcactcttggcgcttatctcggacataagtag
U3JSL7_BCL2L1-01      --tgc-ttctgctgggatcgctgctgagccgcaagtga
U3JTB2_BCL2A1-01      tttcc-ttgttcagagagtactactga-----------
U3KKY6_MCL1-01        --------agccaggggg----gctgg-----------
                                 *   *       **             

© 1998-2020Legal notice