Dataset for CDS BCL-2-like of organism Ficedula albicollis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A803V184_BCL2A1-      atg----------------gaaactgct--------------gagttcta
A0A803VLI1_BCL2L1-      atg------------------tacagcagtaatcgggagttagtgattga
A0A803VR88_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
A0A803VR88_BCL2-02      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
                        ***                    *  *               * * *  *

A0A803V184_BCL2A1-      ttacgtttattac-------------------------------------
A0A803VLI1_BCL2L1-      ctttgtttcttacaagctctcacagaaaggctacagctggagtcagctgg
A0A803VR88_BCL2-01      gtacatccactataaactctcgcagaggggatacgactgg-----gctgc
A0A803VR88_BCL2-02      gtacatccactataaactctcgcagaggggatacgactgg-----gctgc
                         *   *    **                                      

A0A803V184_BCL2A1-      ----------ttagcccagga---------------------------tt
A0A803VLI1_BCL2L1-      aggaggaggatgagaacagga-----ctgactttgcaggggaggaggacg
A0A803VR88_BCL2-01      cgg-------cgagcacagggcacccctgcctcc----------aggtct
A0A803VR88_BCL2-02      cgg-------cgagcacagggcacccctgcctcc----------aggtct
                                    **  ****                              

A0A803V184_BCL2A1-      atctgcagtatgtgct----------------------------ccagga
A0A803VLI1_BCL2L1-      agatggacggcgtgct-caacggaagcccctcctggcacg-cacccacca
A0A803VR88_BCL2-01      ctctgctcctgctgctgctgcggttgctgctgctgctgggacttcctctg
A0A803VR88_BCL2-02      ctctgctcctgctgctgctgcggttgctgctgctgctgggacttcctctg
                           **       ****                            **    

A0A803V184_BCL2A1-      atcacac---------------------ctcggacc--------------
A0A803VLI1_BCL2L1-      gccacatagtgaacggagcctccgtgcaccagagc---------------
A0A803VR88_BCL2-01      atcacactg-ggccggtgtctccgcac-cccgagccccccggctcggctg
A0A803VR88_BCL2-02      atcacactg-ggccggtgtctccgcac-cccgagccccccggctcggctg
                          ****                      *  *  *               

A0A803V184_BCL2A1-      -----agcc---------cagaccagg-----------------------
A0A803VLI1_BCL2L1-      -----agcctcg------aagtccatgagatccgtcgagcagcc---gac
A0A803VR88_BCL2-01      ctgctagccccgcgcccccggccgaggggctgcgccccgcaccccaggtc
A0A803VR88_BCL2-02      ctgctagccccgcgcccccggccgaggggctgcgccccgcaccccaggtc
                             ****           * * * *                       

A0A803V184_BCL2A1-      gttgcccatgtcctgcgaaccatg------gcatcttccctgcaagacca
A0A803VLI1_BCL2L1-      gtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtacc-
A0A803VR88_BCL2-01      gtccacctggtcctgcgccaggcgggcgacgagttctcccggcgctacc-
A0A803VR88_BCL2-02      gtccacctggtcctgcgccaggcgggcgacgagttctcccggcgctacc-
                        **    *  *  *** *      *      *  *     * *    *** 

A0A803V184_BCL2A1-      aaccgaggaggctctcaggccactcctggacaggattgacatcacctcag
A0A803VLI1_BCL2L1-      -----ggcgggcgttcagcgacctcacttcccagctccacatcactccca
A0A803VR88_BCL2-01      -----agagggactttgcccaaatgtctggccagctgcacctgacgccct
A0A803VR88_BCL2-02      -----agagggactttgcccaaatgtctggccagctgcacctgacgccct
                              *  **   *        *      *  * *  ** * **  *  

A0A803V184_BCL2A1-      tagctgttgccaagagaattttcaatggagtcatggatgaaaagtttgct
A0A803VLI1_BCL2L1-      gcac---agcgtatcagagctttgagcaggtagtgaacgaactgttccgc
A0A803VR88_BCL2-01      tcac---ggccaggagccgcttcgtggccgtggtggaggagctcttccga
A0A803VR88_BCL2-02      tcac---ggccaggagccgcttcgtggccgtggtggaggagctcttccga
                           *    **          **       **  ** * **    **    

A0A803V184_BCL2A1-      gatggaaatactaactggggacgaattatgaccatatttacatttggagg
A0A803VLI1_BCL2L1-      gatgga---gtgaactggggccgcatcgtggctttcttctccttcggagg
A0A803VR88_BCL2-01      gacggg---gttaactggggcagaatcgtggccttcttcgagtttggcgg
A0A803VR88_BCL2-02      gacggg---gttaactggggcagaatcgtggccttcttcgagtttggcgg
                        ** **       ********  * **  ** *  * **    ** ** **

A0A803V184_BCL2A1-      tcttctcaccaagaagcttcaagagcat----ggggttcagctgactgca
A0A803VLI1_BCL2L1-      agcctt-------gtgcgtggagagcgttgttaagg---agatgcgggta
A0A803VR88_BCL2-01      cgtgat-------gtgcgtggagagcgtcaacaggg---agatgtctccg
A0A803VR88_BCL2-02      cgtgat-------gtgcgtggagagcgtcaacaggg---agatgtctccg
                             *         ** *  ***** *      **   ** **      

A0A803V184_BCL2A1-      gaggagaaggaggagatctcttatttcatcacagagtacatcatcaacaa
A0A803VLI1_BCL2L1-      ttgg---tgaaacgcatcgtgtcttggatgaccacgtacttgaccgacca
A0A803VR88_BCL2-01      ctgg---tggacagcatcgccgcctggatgaccgagtacctgaaccggca
A0A803VR88_BCL2-02      ctgg---tggacagcatcgccgcctggatgaccgagtacctgaaccggca
                          **    * *    ***      *  ** **   **** * * *    *

A0A803V184_BCL2A1-      caaatccgaatggattgatgcaaatggtggctgggaaaatggcttcctaa
A0A803VLI1_BCL2L1-      cttagatccctggatccaggagaatggcggatggg---agcgctttgtgg
A0A803VR88_BCL2-01      cctgcacaactggatccaggacaacggaggctggg---atgcctttgtgg
A0A803VR88_BCL2-02      cctgcacaactggatccaggacaacggaggctggg---aca-------ga
                        *         *****  * *  ** ** ** ****   *           

A0A803V184_BCL2A1-      caaagtttgaaagaagatcactactgtc----------------cttctc
A0A803VLI1_BCL2L1-      acctctatgggaac-----gatgctgct----------------gccgag
A0A803VR88_BCL2-01      agttgtatggcaacagtatgaggcctttgttcgatttctcctggatctct
A0A803VR88_BCL2-02      agctgcttcgcca------aatactttt------ttgtagctgcacagct
                               *               *                          

A0A803V184_BCL2A1-      caaaattacagccc--------tgttcatagctg------------ttgt
A0A803VLI1_BCL2L1-      gtggatcccagtcc------------cgtggcagcca---------ctct
A0A803VR88_BCL2-01      ctgaagactatcctgagtctggttctggtgggagcttgcatca---ctct
A0A803VR88_BCL2-02      atggataccagctt--------------tggataccaacacaagggctat
                            *    *                  * *                * *

A0A803V184_BCL2A1-      ttccttgttcagagagtactactga
A0A803VLI1_BCL2L1-      c---------------------tga
A0A803VR88_BCL2-01      tggcgcttatctcggacataagtag
A0A803VR88_BCL2-02      tcatgcttctccactggaaaaatga
                                              *  

© 1998-2022Legal notice