Dataset for CDS BCL-2 of organism Macaca fascicularis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A7N9CNB8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgccgcc
gccgtcgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
© 1998-2022Legal notice