Dataset for CDS BCL-2-like of organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6AD27_BCL2A1-      atgacagactgtg-----------------aatttggatatatt------
A0A2K6AD27_BCL2A1-      atgacagactgtg-----------------aatttggatatatt------
A0A2K5XRD4_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K5YR37_BCL2L1-      atgtctcagagca------------------accgggagctggtggttga
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      atg-----------------------------tttgg-------------
A0A2K5XSB2_MCL1-03      atg-----------------------------tttgg-------------
A0A2K6AI25_BCL2L2-      atggcgaccccag------------------cctcgg-------------
A0A2K6AI25_BCL2L2-      atggcgaccccag------------------cctcgg-------------
                                                                          

A0A2K6AD27_BCL2A1-      ----------tacaggctagctcaggactatt------------------
A0A2K6AD27_BCL2A1-      ----------tacaggctagctcaggactatt------------------
A0A2K5XRD4_BCL2-01      gtacatccactataagctgtcgcagaggggctacgag-------------
A0A2K5YR37_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagc-------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      -------------------cctcaaaagaaacgcggtaatcggactcaac
A0A2K5XSB2_MCL1-03      -------------------cctcaaaagaaacgcggtaatcggactcaac
A0A2K6AI25_BCL2L2-      -------------------cccc---agacacacggg-------------
A0A2K6AI25_BCL2L2-      -------------------cccc---agacacacggg-------------
                                                                          

A0A2K6AD27_BCL2A1-      -----------tgcagtatgttctgcagataccacaac-------ctgga
A0A2K6AD27_BCL2A1-      -----------tgcagtatgttctgcagataccacaac-------ctgga
A0A2K5XRD4_BCL2-01      ---------tgggatgcgggggatgtgggcgcggcgaccc-----ctggg
A0A2K5YR37_BCL2L1-      -----------tggagtcagtttagtgatgtggaagagaacaggactgag
A0A2K5YR37_BCL2L1-      ---------------------------atgtggaagagaacaggactgag
A0A2K5XSB2_MCL1-01      ctctactgtgggggggccggc-ttgggggccggcag---------cggcg
A0A2K5XSB2_MCL1-03      ctctactgtgggggggccggc-ttgggggccggcag---------cggcg
A0A2K6AI25_BCL2L2-      ctct-------ggtggcagactttgtaggttataag---------ctgag
A0A2K6AI25_BCL2L2-      ctct-------ggtggcagactttgtaggttataag---------ctgag
                                                                     * *  

A0A2K6AD27_BCL2A1-      t-------------------------------------------------
A0A2K6AD27_BCL2A1-      t-------------------------------------------------
A0A2K5XRD4_BCL2-01      g-----tcgcccccgcaccgggcatcttctcctcccag------------
A0A2K5YR37_BCL2L1-      g--------ccccagaagggactgaatcggagatggag------------
A0A2K5YR37_BCL2L1-      g--------ccccagaagggactgaatcggagatggag------------
A0A2K5XSB2_MCL1-01      gcgccacccctccgggagggcggcttttggctacggagaaggaggcctcg
A0A2K5XSB2_MCL1-03      gcgccacccctccgggagggcggctttt----------------------
A0A2K6AI25_BCL2L2-      g-----------cagaaggg----ttatgtctgtggag------------
A0A2K6AI25_BCL2L2-      g-----------cagaaggg----ttatgtctgtggag------------
                                                                          

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      gcccggcgagagatagggggaggggaggccggcacggtgattggcggaag
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      cgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcg
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      cgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgaccccc
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      gcgaggctgtttttctttgcgcccacccgccgcgcggcgccgcttgagga
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      gatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctgg
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      acgggtacgagccggagcctctcgggaagcggccggctgtcctgcccctg
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      ctggagttggtcggggaatctggtaatagccccagtacggatgggtcact
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      ----------------cccgggcacacgccccatcccgccgcgtcccggg
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      accctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggc
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6AD27_BCL2A1-      ------------------------------------------cgggtcca
A0A2K6AD27_BCL2A1-      ------------------------------------------cgggtcca
A0A2K5XRD4_BCL2-01      acccggtcgccaggacctcgccactgccgaccccggctgcccccgccgcc
A0A2K5YR37_BCL2L1-      --------------------------------------acccccagtgcc
A0A2K5YR37_BCL2L1-      --------------------------------------acccccagtgcc
A0A2K5XSB2_MCL1-01      agtcgctggagattatctctcggtaccttcgggagcaggccaccggcgcc
A0A2K5XSB2_MCL1-03      -------------------------------------ggccaccggcgcc
A0A2K6AI25_BCL2L2-      ------------------------------------------ctggcccc
A0A2K6AI25_BCL2L2-      ------------------------------------------ctggcccc
                                                                  *     * 

A0A2K6AD27_BCL2A1-      agcaa---------------------------------------------
A0A2K6AD27_BCL2A1-      agcaa---------------------------------------------
A0A2K5XRD4_BCL2-01      gccgc---------------------------------------------
A0A2K5YR37_BCL2L1-      atcaatggcaacccatcctggcacctggtggacagccccgcggtgaatgg
A0A2K5YR37_BCL2L1-      atcaatggcaacccatcct-------------------------------
A0A2K5XSB2_MCL1-01      aaggacacaaagcca------------------------------atggg
A0A2K5XSB2_MCL1-03      aaggacacaaagcca------------------------------atggg
A0A2K6AI25_BCL2L2-      gggga---------------------------------------------
A0A2K6AI25_BCL2L2-      gggga---------------------------------------------
                                                                          

A0A2K6AD27_BCL2A1-      -------------aacgtccagagtgctac-----------------aaa
A0A2K6AD27_BCL2A1-      -------------aacgtccagagtgctac-----------------aaa
A0A2K5XRD4_BCL2-01      -------ggggcctgcgctcagcccggtgc-----------------cac
A0A2K5YR37_BCL2L1-      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      caggtctggggccaccagcaggaaggct-c--------------------
A0A2K5XSB2_MCL1-03      caggtctggggccaccagcaggaaggct-c--------------------
A0A2K6AI25_BCL2L2-      -------gggcccagcagctgacccgctgc--------------------
A0A2K6AI25_BCL2L2-      -------gggcccagcagctgacccgctgc--------------------
                                                                          

A0A2K6AD27_BCL2A1-      aggttgcattctcagtccaaaaagaagtggaaaagaatct----------
A0A2K6AD27_BCL2A1-      aggttgcattctcagtccaaaaagaagtggaaaagaatct----------
A0A2K5XRD4_BCL2-01      ctgtggtccacctgaccctccgccaggccggtgacgactt----------
A0A2K5YR37_BCL2L1-      cagcagtaaagcaagcgctgagggaggcaggcgacgagtt----------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      ---------tggagaccttacgacgggttggggatggcgtgcagcgcaac
A0A2K5XSB2_MCL1-03      ---------tggagaccttacgacgggttggggatggcgtgcagcgcaac
A0A2K6AI25_BCL2L2-      ---------accaagccatgcgggcagctggagatgagtt----------
A0A2K6AI25_BCL2L2-      ---------accaagccatgcgggcagctggagatgagtt----------
                                                                          

A0A2K6AD27_BCL2A1-      -----gaagccatgcttggacaatgttaatg--------------ttgca
A0A2K6AD27_BCL2A1-      -----gaagccatgcttggacaatgttaatg--------------ttgca
A0A2K5XRD4_BCL2-01      --ctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgca
A0A2K5YR37_BCL2L1-      --tgaactgcggtaccggcgggcgttcagtgacctgacatcccagctcca
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      cacgagacggccttccaaggcatgcttcggaaactgg----------aca
A0A2K5XSB2_MCL1-03      cacgagacggccttccaaggcatgcttcggaaactgg----------aca
A0A2K6AI25_BCL2L2-      --cgagacccgcttccggcgcaccttctctgatctggcggctcagctgca
A0A2K6AI25_BCL2L2-      --cgagacccgcttccggcgcaccttctctgatctggcggctcagctgca
                                                                          

A0A2K6AD27_BCL2A1-      tcca----tagacactgccagaacactattcaatcaagtgatggaaaa--
A0A2K6AD27_BCL2A1-      tcca----tagacactgccagaacactattcaatcaagtgatggaaaa--
A0A2K5XRD4_BCL2-01      cctgacgcccttcaccgcgcggggacgctttgccacggtggtggagga--
A0A2K5YR37_BCL2L1-      catcaccccagggacagcatatcagagctttgaacaggtagtgaatga--
A0A2K5YR37_BCL2L1-      ----------gggacagcatatcagagctttgaacaggtagtgaatga--
A0A2K5XSB2_MCL1-01      tcaaaaacgaag---------acgatgtcaaatctttgtctcgagtgatg
A0A2K5XSB2_MCL1-03      tcaaaaacgaag---------acgatgtcaaatctttgtctcgagtgatg
A0A2K6AI25_BCL2L2-      tgtgaccccaggctcagcacagcaacgcttcacccaggtctccgatga--
A0A2K6AI25_BCL2L2-      tgtgaccccaggctcagcacagcaacgcttcacccaggtctccgatga--
                                                             **        *  

A0A2K6AD27_BCL2A1-      ----ggagtttgaagatggca-tcattaactggggaagaattgtaaccat
A0A2K6AD27_BCL2A1-      ----ggagtttgaagatggca-tcattaactggggaagaattgtaaccat
A0A2K5XRD4_BCL2-01      ----gctcttcagggacgggg----tgaactgggggaggatcgtggcctt
A0A2K5YR37_BCL2L1-      ----actcttccgggatgggg----taaactggggtcgcattgtggcctt
A0A2K5YR37_BCL2L1-      ----actcttccgggatgggg----taaactggggtcgcattgtggcctt
A0A2K5XSB2_MCL1-01      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A2K5XSB2_MCL1-03      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A2K6AI25_BCL2L2-      ----acttttccaagggggcc----ccaactggggccgccttgtagcctt
A0A2K6AI25_BCL2L2-      ----acttttccaagggggcc----ccaactggggccgccttgtagcctt
                                **        *        ********  *  * **  *  *

A0A2K6AD27_BCL2A1-      atttgcatttgaaggtattctca-------------tcaagaaacttcta
A0A2K6AD27_BCL2A1-      atttgcatttgaaggtattctca-------------tcaagaaacttcta
A0A2K5XRD4_BCL2-01      ctttgagttcggtggggtcatgtgtg----------tggaga-------g
A0A2K5YR37_BCL2L1-      tttctccttcggcggggcactgtgcg----------tggaaa-------g
A0A2K5YR37_BCL2L1-      tttctccttcggcggggcactgtgcg----------tggaaa-------g
A0A2K5XSB2_MCL1-01      catttcttttggtgc----ctttgtggctaaacacttgaaga-------c
A0A2K5XSB2_MCL1-03      catttcttttggtgc----ctttgtggctaaacacttgaaga-------c
A0A2K6AI25_BCL2L2-      ctttgtctttggggctgcactgtgtg----------ctgaga-------g
A0A2K6AI25_BCL2L2-      ctttgtctttggggctgcactgtgtg----------ctgaga-------g
                          *    ** *  *      *                  * *        

A0A2K6AD27_BCL2A1-      cgacagcgaattgccccggatgtggatacttataaggag-atttcgtatt
A0A2K6AD27_BCL2A1-      cgacagcgaattgccccggatgtggatacttataaggag-atttcgtatt
A0A2K5XRD4_BCL2-01      cgtcaaccgggag------atgtcgcccctggtggacaacatcgccc-tg
A0A2K5YR37_BCL2L1-      cgtagacaaggag------atgcaggtattggtgagtcggatcgcag-ct
A0A2K5YR37_BCL2L1-      cgtagacaaggag------atgcaggtattggtgagtcggatcgcag-ct
A0A2K5XSB2_MCL1-01      cataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacg
A0A2K5XSB2_MCL1-03      cataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacg
A0A2K6AI25_BCL2L2-      tgtcaacaaggag------atggaaccactggtgggaca-agtgcaggag
A0A2K6AI25_BCL2L2-      tgtcaacaaggag------atggaaccactggtgggaca-agtgcaggag
                              *            **        *          *   *     

A0A2K6AD27_BCL2A1-      ttgttgctgagttcataatgaataacactggagaa-tggataaggcaaaa
A0A2K6AD27_BCL2A1-      ttgttgctgagttcataatgaataacactggagaa-tggataaggcaaaa
A0A2K5XRD4_BCL2-01      tggatgactgagtacctgaaccggcacctgcacacctggatccaggataa
A0A2K5YR37_BCL2L1-      tggatggccacttacctgaatgaccacctagagccttggatccaggagaa
A0A2K5YR37_BCL2L1-      tggatggccacttacctgaatgaccacctagagccttggatccaggagaa
A0A2K5XSB2_MCL1-01      ttctcgtaaggaca-----aaacgggactggctagttaaacaaa------
A0A2K5XSB2_MCL1-03      ttctcgtaaggaca-----aaacgggactggctagttaaacaaa------
A0A2K6AI25_BCL2L2-      tggatggtggcctacctggagacgcggctggctgactggatccacagcag
A0A2K6AI25_BCL2L2-      tggatggtggcctacctggagacgcggctggctgactggatccacagcag
                        *    *                     **       *  *          

A0A2K6AD27_BCL2A1-      cggaggct-gggaaa-----------------------------------
A0A2K6AD27_BCL2A1-      cggaggctgggggaa-----------------------------------
A0A2K5XRD4_BCL2-01      cggaggctggg---------------------------------------
A0A2K5YR37_BCL2L1-      cggcggctggg---------------------------------------
A0A2K5YR37_BCL2L1-      cggcggctggg---------------------------------------
A0A2K5XSB2_MCL1-01      --gaggctggg---------------------------------------
A0A2K5XSB2_MCL1-03      --gaggctggg---------------------------------------
A0A2K6AI25_BCL2L2-      tgggggctgggcg------gagttcacagctctatacgggg---------
A0A2K6AI25_BCL2L2-      tgggggctgggagctggaagctatcaaagctcgagtcagggagatggagg
                          * **** **                                       

A0A2K6AD27_BCL2A1-      ------------------------------atg-----------------
A0A2K6AD27_BCL2A1-      ------------------------------atg-----------------
A0A2K5XRD4_BCL2-01      ------------------------------acg-----------------
A0A2K5YR37_BCL2L1-      ------------------------------aca-----------------
A0A2K5YR37_BCL2L1-      ------------------------------aca-----------------
A0A2K5XSB2_MCL1-01      ------------------------------atgggt--------------
A0A2K5XSB2_MCL1-03      ------------------------------atgggt--------------
A0A2K6AI25_BCL2L2-      ------------------------------acgggg--------------
A0A2K6AI25_BCL2L2-      aagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatg
                                                      *                   

A0A2K6AD27_BCL2A1-      -------------------------------------------gctttgt
A0A2K6AD27_BCL2A1-      -------------------------------------------gc-----
A0A2K5XRD4_BCL2-01      -------------------------------------------cctttgt
A0A2K5YR37_BCL2L1-      -------------------------------------------cttttgt
A0A2K5YR37_BCL2L1-      -------------------------------------------cttttgt
A0A2K5XSB2_MCL1-01      ----------------------------------------------ttgt
A0A2K5XSB2_MCL1-03      ----------------------------------------------ttgt
A0A2K6AI25_BCL2L2-      -------------------------------------------ccctgga
A0A2K6AI25_BCL2L2-      aatatgagtccacctccaggcaatgctggcccagtgatcatgtccattga
                                                                          

A0A2K6AD27_BCL2A1-      aaag----------------------------------------------
A0A2K6AD27_BCL2A1-      --ac----------------------------------------------
A0A2K5XRD4_BCL2-01      ggaa----------------------------------------------
A0A2K5YR37_BCL2L1-      ggaa------------------------ctctatgggaacaatg------
A0A2K5YR37_BCL2L1-      ggaa------------------------ctctatgggaacaatg------
A0A2K5XSB2_MCL1-01      ggag---------------------ttcttccatgt--------------
A0A2K5XSB2_MCL1-03      ggag---------------------ttcttccatgt--------------
A0A2K6AI25_BCL2L2-      ggaggcg-cggcgtctg---------------------------------
A0A2K6AI25_BCL2L2-      ggagaagatggaggctgatgcccgttccatctatgttggcaatgtggact
                          *                                               

A0A2K6AD27_BCL2A1-      ------------aagtttgaacctaaat----------------------
A0A2K6AD27_BCL2A1-      ------------aatcacatgcctatg-----------------------
A0A2K5XRD4_BCL2-01      ---------ctgta---cggccccagcatgcg------------------
A0A2K5YR37_BCL2L1-      ---------cagcagccgagagccgaaa----------------------
A0A2K5YR37_BCL2L1-      ---------cagcagccgagagccgaaa----------------------
A0A2K5XSB2_MCL1-01      -------------ag--aggacctagaaggtg------------------
A0A2K5XSB2_MCL1-03      -------------ag--aggacctagaaggtg------------------
A0A2K6AI25_BCL2L2-      ---------cgggag--gggaactgg------------------------
A0A2K6AI25_BCL2L2-      atggtgcaacagcag--aagagctggaagctcactttcatggctgtggat
                                     *        *                           

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      cagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
                                                                          

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      ------------------------------gcctctgtttgatttctcct
A0A2K5YR37_BCL2L1-      ------------------------------gggccaggagcgcttcaacc
A0A2K5YR37_BCL2L1-      ------------------------------gggccaggagcgcttcaacc
A0A2K5XSB2_MCL1-01      ------------------------------gcatcagaaa----------
A0A2K5XSB2_MCL1-03      ------------------------------gcatcagaaa----------
A0A2K6AI25_BCL2L2-      ------------------------------gcatcagtgaggac------
A0A2K6AI25_BCL2L2-      ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttcctt
                                                                          

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      g--------------------------------------gctgtctctga
A0A2K5YR37_BCL2L1-      ---------------------------------------gctggttc---
A0A2K5YR37_BCL2L1-      ---------------------------------------gctggttc---
A0A2K5XSB2_MCL1-01      ---------------------------------------tgtg-------
A0A2K5XSB2_MCL1-03      ---------------------------------------tgtg-------
A0A2K6AI25_BCL2L2-      ---------------------------------------agtg-------
A0A2K6AI25_BCL2L2-      ggccttagatgagtccctatttagaggaaggcaaatcaaggtgatcccaa
                                                                          

A0A2K6AD27_BCL2A1-      ------------------------------ctggctgga-----------
A0A2K6AD27_BCL2A1-      ------------------------------ctagtagag-----------
A0A2K5XRD4_BCL2-01      agact-------------------------ctgctcagtt----------
A0A2K5YR37_BCL2L1-      ------------------------------ctgacgggca----------
A0A2K5YR37_BCL2L1-      ------------------------------ctgacgggca----------
A0A2K5XSB2_MCL1-01      ------------------------------ctgc----------------
A0A2K5XSB2_MCL1-03      ------------------------------ctgc----------------
A0A2K6AI25_BCL2L2-      ------------------------------ctgacggggg----------
A0A2K6AI25_BCL2L2-      aacgaaccaacagaccaggcatcagcacaacagaccggggttttccacga
                                                      *                   

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      gcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgatt
                                                                          

A0A2K6AD27_BCL2A1-      ------tgacttttctagaagttacaggaaagatctgtgaaatgctc---
A0A2K6AD27_BCL2A1-      ------tcagtggcccacaggaagaagaaaatggctttgtaa--------
A0A2K5XRD4_BCL2-01      ------tggccctggtgggagctt--------gcatcaccctgggtg---
A0A2K5YR37_BCL2L1-      ------tgactgtggccggcgt----------ggttctgctgggctc---
A0A2K5YR37_BCL2L1-      ------tgactgtggccggcgt----------ggttctgctgggctc---
A0A2K5XSB2_MCL1-01      ------tggcttttgcaggtgttgctggagtaggagctggtttggca---
A0A2K5XSB2_MCL1-03      ------tggcttttgcaggtgttgctggagtaggagctggtttggca---
A0A2K6AI25_BCL2L2-      ---ccgtggc----actgggggccctg-----gtaactgtaggggcc---
A0A2K6AI25_BCL2L2-      ctacagtggttttaacagcaggccccggggtcgtgtctacaggggccggg
                              *             *                             

A0A2K6AD27_BCL2A1-      ------------tctctcctgaagcaatactgttga
A0A2K6AD27_BCL2A1-      ------------------------------------
A0A2K5XRD4_BCL2-01      ---------------cctatctgggccacaag-tga
A0A2K5YR37_BCL2L1-      ---------------actcttcagtcggaaa--tga
A0A2K5YR37_BCL2L1-      ---------------actcttcagtcggaaa--tga
A0A2K5XSB2_MCL1-01      -----------------tat----ctaataagatag
A0A2K5XSB2_MCL1-03      -----------------tat----ctaataagatag
A0A2K6AI25_BCL2L2-      -----------------ttttttgctagcaag-tga
A0A2K6AI25_BCL2L2-      ctagagcgacatcatggtattccccttac----taa
                                                            

© 1998-2020Legal notice