Dataset for CDS BCL-2-like of organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6AD27_BCL2A1-      atgacagactgtgaatt------tggatatatttacaggctagctcagga
A0A2K6AD27_BCL2A1-      atgacagactgtgaatt------tggatatatttacaggctagctcagga
A0A2K5XRD4_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K5XSB2_MCL1-02      ----------atgtttggcc---tcaaaagaaacgcggt-----------
A0A2K5XSB2_MCL1-01      ----------atgtttggcc---tcaaaagaaacgcggt-----------
A0A2K5XSB2_MCL1-03      ----------atgtttggcc---tcaaaagaaacgcggt-----------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ---------------atgtc---tcagagcaaccgggagctggtggttga
A0A2K5YR37_BCL2L1-      ---------------atgtc---tcagagcaaccgggagctggtggttga
A0A2K6AI25_BCL2L2-      atggcgaccccagcctcggc---cccagacacacgggctctggtggcaga
A0A2K6AI25_BCL2L2-      atggcgaccccagcctcggc---cccagacacacgggctctggtggcaga
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      ctatttgcagtatgttctgcag----------------------------
A0A2K6AD27_BCL2A1-      ctatttgcagtatgttctgcag----------------------------
A0A2K5XRD4_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtgg----------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
A0A2K5YR37_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
A0A2K6AI25_BCL2L2-      ctttgtaggttataagctgaggcagaagggttatgtctgt----------
A0A2K6AI25_BCL2L2-      ctttgtaggttataagctgaggcagaagggttatgtctgt----------
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      ------------------ataccacaacct----------ggatcgggtc
A0A2K6AD27_BCL2A1-      ------------------ataccacaacct----------ggatcgggtc
A0A2K5XRD4_BCL2-01      --gatgcgggggatgtgggcgcggcgacccct-------ggggtcgcccc
A0A2K5XSB2_MCL1-02      --------------aatcggactcaacctctactgtgggggggccggctt
A0A2K5XSB2_MCL1-01      --------------aatcggactcaacctctactgtgggggggccggctt
A0A2K5XSB2_MCL1-03      --------------aatcggactcaacctctactgtgggggggccggctt
A0A2K5YR37_BCL2L1-      ---atgtggaagagaacaggactgaggcccca----gaagggactgaatc
A0A2K5YR37_BCL2L1-      gtgatgtggaagagaacaggactgaggcccca----gaagggactgaatc
A0A2K5YR37_BCL2L1-      gtgatgtggaagagaacaggactgaggcccca----gaagggactgaatc
A0A2K6AI25_BCL2L2-      ------------------ggagctggccccgg----ggagggccc-----
A0A2K6AI25_BCL2L2-      ------------------ggagctggccccgg----ggagggccc-----
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      caagcaaaacgtccagagtgctaca-------------------------
A0A2K6AD27_BCL2A1-      caagcaaaacgtccagagtgctaca-------------------------
A0A2K5XRD4_BCL2-01      cgcaccgggcatcttctcctcc---------------cagcccgggcaca
A0A2K5XSB2_MCL1-02      gggggccggcagcggcggcgccacccctccgggagggcggcttttggcta
A0A2K5XSB2_MCL1-01      gggggccggcagcggcggcgccacccctccgggagggcggcttttggcta
A0A2K5XSB2_MCL1-03      gggggccggcagcggcggcgccacccctccgggagggcggctttt-----
A0A2K5YR37_BCL2L1-      ggagatggagacccccagtgccatc-------------------------
A0A2K5YR37_BCL2L1-      ggagatggagacccccagtgccatc-------------------------
A0A2K5YR37_BCL2L1-      ggagatggagacccccagtgccatc-------------------------
A0A2K6AI25_BCL2L2-      --agcagctgacccgctgcacca---------------------------
A0A2K6AI25_BCL2L2-      --agcagctgacccgctgcacca---------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      -aaaggttgcattctcagtccaaaaagaagtggaaaa-------------
A0A2K6AD27_BCL2A1-      -aaaggttgcattctcagtccaaaaagaagtggaaaa-------------
A0A2K5XRD4_BCL2-01      cgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccactg
A0A2K5XSB2_MCL1-02      cggagaaggaggcctcggcccggcgagagatagggggaggggaggccggc
A0A2K5XSB2_MCL1-01      cggagaaggaggcctcggcccggcgagagatagggggaggggaggccggc
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -----aatggcaacccatcct-----------------------------
A0A2K5YR37_BCL2L1-      -----aatggcaacccatcctggcacctggtggacagccccgcggtgaat
A0A2K5YR37_BCL2L1-      -----aatggcaacccatcctggcacctggtggacagccccgcggtgaat
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      ccgaccccggctgcccccgccgccgccgcggggcctgcgctcagcccggt
A0A2K5XSB2_MCL1-02      acgg---tgattggcggaagcgccggcgcaagccccccggccgccctcac
A0A2K5XSB2_MCL1-01      acgg---tgattggcggaagcgccggcgcaagccccccggccgccctcac
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ggag---ccactggccacagcagcagtttggatgcccgggaggtgatccc
A0A2K5YR37_BCL2L1-      ggag---ccactggccacagcagcagtttggatgcccgggaggtgatccc
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      ----------------------------gaatctgaagccatgcttggac
A0A2K6AD27_BCL2A1-      ----------------------------gaatctgaagccatgcttggac
A0A2K5XRD4_BCL2-01      gccacctgtggtccacctgaccctccgccaggccggtgacgacttctccc
A0A2K5XSB2_MCL1-02      gccagacgcccggagggtcgcgcggccgccgcccattggcgcggaggtcc
A0A2K5XSB2_MCL1-01      gccagacgcccggagggtcgcgcggccgccgcccattggcgcggaggtcc
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      catggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaac
A0A2K5YR37_BCL2L1-      catggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaac
A0A2K6AI25_BCL2L2-      ------------------agccatgcgggcagctggagatgagttcgaga
A0A2K6AI25_BCL2L2-      ------------------agccatgcgggcagctggagatgagttcgaga
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      a--------atgttaatgttgcat--------------------------
A0A2K6AD27_BCL2A1-      a--------atgttaatgttgcat--------------------------
A0A2K5XRD4_BCL2-01      g--------ccgctaccgccgcgacttcgccgagatgtccagccagctgc
A0A2K5XSB2_MCL1-02      ccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgc
A0A2K5XSB2_MCL1-01      ccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgc
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      t--------gcggtaccggcgggcgttcagtgacctgacatcccagctcc
A0A2K5YR37_BCL2L1-      t--------gcggtaccggcgggcgttcagtgacctgacatcccagctcc
A0A2K6AI25_BCL2L2-      c--------ccgcttccggcgcaccttctctgatctggcggctcagctgc
A0A2K6AI25_BCL2L2-      c--------ccgcttccggcgcaccttctctgatctggcggctcagctgc
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      ------ccatagacactgccagaacactattcaatcaagtgatggaaaag
A0A2K6AD27_BCL2A1-      ------ccatagacactgccagaacactattcaatcaagtgatggaaaag
A0A2K5XRD4_BCL2-01      acctgacgcccttcaccgcgcggggacgctttgccacggtggtggaggag
A0A2K5XSB2_MCL1-02      cgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcat
A0A2K5XSB2_MCL1-01      cgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcat
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -----------gggacagcatatcagagctttgaacaggtagtgaatgaa
A0A2K5YR37_BCL2L1-      acatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaa
A0A2K5YR37_BCL2L1-      acatcaccccagggacagcatatcagagctttgaaca-------------
A0A2K6AI25_BCL2L2-      atgtgaccccaggctcagcacagcaacgcttcacccaggtctccgatgaa
A0A2K6AI25_BCL2L2-      atgtgaccccaggctcagcacagcaacgcttcacccaggtctccgatgaa
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      gagtttgaagatggcatcattaactggggaagaattgtaaccatat----
A0A2K6AD27_BCL2A1-      gagtttgaagatggcatcattaactggggaagaattgtaaccatat----
A0A2K5XRD4_BCL2-01      ctcttcagggacggggtg---aactgggggaggatcgtggccttct----
A0A2K5XSB2_MCL1-02      gtcgcccgaagaggagct---ggacgggtacgagccggagcctctcggga
A0A2K5XSB2_MCL1-01      gtcgcccgaagaggagct---ggacgggtacgagccggagcctctcggga
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ctcttccgggatggggta---aactggggtcgcattgtggcctttt----
A0A2K5YR37_BCL2L1-      ctcttccgggatggggta---aactggggtcgcattgtggcctttt----
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      cttttccaagggggcccc---aactggggccgccttgtagccttct----
A0A2K6AI25_BCL2L2-      cttttccaagggggcccc---aactggggccgccttgtagccttct----
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      -----------------ttgcatttgaaggtattct-------catcaag
A0A2K6AD27_BCL2A1-      -----------------ttgcatttgaaggtattct-------catcaag
A0A2K5XRD4_BCL2-01      -----------------ttgagttcggtggggtcatgtg----tgtggag
A0A2K5XSB2_MCL1-02      agcggccggctgtcctgcccctgctggagttggtcggggaatctggtaat
A0A2K5XSB2_MCL1-01      agcggccggctgtcctgcccctgctggagttggtcggggaatctggtaat
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -----------------tctccttcggcggggcactgtg----cgtggaa
A0A2K5YR37_BCL2L1-      -----------------tctccttcggcggggcactgtg----cgtggaa
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      -----------------ttgtctttggggctgcactgtg----tgctgag
A0A2K6AI25_BCL2L2-      -----------------ttgtctttggggctgcactgtg----tgctgag
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      aaacttctacgacagcgaattgccccggatgtggatacttataaggagat
A0A2K6AD27_BCL2A1-      aaacttctacgacagcgaattgccccggatgtggatacttataaggagat
A0A2K5XRD4_BCL2-01      agcgt----caaccggga---------gatgtcgcccctggtggacaaca
A0A2K5XSB2_MCL1-02      agccc----cagtacgga---------tgggtcactaccctcgacgccgc
A0A2K5XSB2_MCL1-01      agccc----cagtacgga---------tgggtcactaccctcgacgccgc
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      agcgt----agacaagga---------gatgcaggtattggtgagtcgga
A0A2K5YR37_BCL2L1-      agcgt----agacaagga---------gatgcaggtattggtgagtcgga
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      agtgt----caacaagga---------gatggaaccactggtgggacaag
A0A2K6AI25_BCL2L2-      agtgt----caacaagga---------gatggaaccactggtgggacaag
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      ttcgtattttgttg------------------------------------
A0A2K6AD27_BCL2A1-      ttcgtattttgttg------------------------------------
A0A2K5XRD4_BCL2-01      tcgccctgtggatgactg--------------------------------
A0A2K5XSB2_MCL1-02      cgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatt
A0A2K5XSB2_MCL1-01      cgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatt
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      tcgcagcttggatggcca--------------------------------
A0A2K5YR37_BCL2L1-      tcgcagcttggatggcca--------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      tgcaggagtggatggtgg--------------------------------
A0A2K6AI25_BCL2L2-      tgcaggagtggatggtgg--------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      ------------------------------------ctgagttca----t
A0A2K6AD27_BCL2A1-      ------------------------------------ctgagttca----t
A0A2K5XRD4_BCL2-01      -----------agtacctgaaccggcacctgcacacctggatccagga-t
A0A2K5XSB2_MCL1-02      atctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagcc
A0A2K5XSB2_MCL1-01      atctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagcc
A0A2K5XSB2_MCL1-03      -----------------------ggccaccggcgccaaggacacaaagcc
A0A2K5YR37_BCL2L1-      -----------cttacctgaatgaccacctagagccttggatccagga-g
A0A2K5YR37_BCL2L1-      -----------cttacctgaatgaccacctagagccttggatccagga-g
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      -----------cctacctggagacgcggctggctgactggatccacag-c
A0A2K6AI25_BCL2L2-      -----------cctacctggagacgcggctggctgactggatccacag-c
A0A2K6AI25_BCL2L2-      --------------------------------------------------

A0A2K6AD27_BCL2A1-      aatgaataacactgga----------------------------------
A0A2K6AD27_BCL2A1-      aatgaataacactgga----------------------------------
A0A2K5XRD4_BCL2-01      aacgg---aggctggg----------------------------------
A0A2K5XSB2_MCL1-02      aatgggcaggtctggg----------------------------------
A0A2K5XSB2_MCL1-01      aatgggcaggtctggg----------------------------------
A0A2K5XSB2_MCL1-03      aatgggcaggtctggg----------------------------------
A0A2K5YR37_BCL2L1-      aacgg---cggctggg----------------------------------
A0A2K5YR37_BCL2L1-      aacgg---cggctggg----------------------------------
A0A2K5YR37_BCL2L1-      --------------gg----------------------------------
A0A2K6AI25_BCL2L2-      agtgg---gggctgggcg--------------------------------
A0A2K6AI25_BCL2L2-      agtgg---gggctgggagctggaagctatcaaagctcgagtcagggagat
A0A2K6AI25_BCL2L2-      ------------------------------------------------at

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5XSB2_MCL1-02      ---gccaccagcaggaaggctctggagaccttacgacgggttggggatgg
A0A2K5XSB2_MCL1-01      ---gccaccagcaggaaggctctggagaccttacgacgggttggggatgg
A0A2K5XSB2_MCL1-03      ---gccaccagcaggaaggctctggagaccttacgacgggttggggatgg
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      ggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagc
A0A2K6AI25_BCL2L2-      ggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagc

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      -----------------acgcctttgtg---------------------g
A0A2K5XSB2_MCL1-02      cgtgcagcgcaaccacgagacggccttccaa-------------------
A0A2K5XSB2_MCL1-01      cgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactgg
A0A2K5XSB2_MCL1-03      cgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactgg
A0A2K5YR37_BCL2L1-      -----------------acacttttgtg---------------------g
A0A2K5YR37_BCL2L1-      -----------------acacttttgtg---------------------g
A0A2K5YR37_BCL2L1-      -----------------acacttttgtg---------------------g
A0A2K6AI25_BCL2L2-      ----------gagttc-acagctctatacggggacgg------------g
A0A2K6AI25_BCL2L2-      agatgaatatgagtcc-ac--ctccaggcaatgctggcccagtgatcatg
A0A2K6AI25_BCL2L2-      agatgaatatgagtcc-ac--ctccaggcaatgctggcccagtgatcatg

A0A2K6AD27_BCL2A1-      ----gaatggataaggca--------------------------------
A0A2K6AD27_BCL2A1-      ----gaatggataaggca--------------------------------
A0A2K5XRD4_BCL2-01      aactgtacgg----------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      acatcaaaaacgaagacgatgtcaaatctttgtctcgagtg-atggtcca
A0A2K5XSB2_MCL1-03      acatcaaaaacgaagacgatgtcaaatctttgtctcgagtg-atggtcca
A0A2K5YR37_BCL2L1-      aactctatgggaacaatg--------------------------------
A0A2K5YR37_BCL2L1-      aactctatgggaacaatg--------------------------------
A0A2K5YR37_BCL2L1-      aactctatgggaacaatg--------------------------------
A0A2K6AI25_BCL2L2-      gccctggaggaggcg-cggcgtctg-------------------------
A0A2K6AI25_BCL2L2-      tccattgaggagaagatggaggctgatgcccgttccatctatgttggcaa
A0A2K6AI25_BCL2L2-      tccattgaggagaagatggaggctgatgcccgttccatctatgttggcaa

A0A2K6AD27_BCL2A1-      ---------------------aaacggaggct-g----------------
A0A2K6AD27_BCL2A1-      ---------------------aaacggaggctgg----------------
A0A2K5XRD4_BCL2-01      --------------ccccagcatgcggcctctgtttgatttctcct----
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      tgttttcagcgacggcgtaacaaactggggcaggattgtgactctcattt
A0A2K5XSB2_MCL1-03      tgttttcagcgacggcgtaacaaactggggcaggattgtgactctcattt
A0A2K5YR37_BCL2L1-      -----------------cagcagccgagagccga----------------
A0A2K5YR37_BCL2L1-      -----------------cagcagccgagagccga----------------
A0A2K5YR37_BCL2L1-      -----------------cagcagccgagagccga----------------
A0A2K6AI25_BCL2L2-      -----------------cgggag--gggaactgg----------------
A0A2K6AI25_BCL2L2-      tgtggactatggtgcaacagcag--aagagctggaagctcactttcatgg
A0A2K6AI25_BCL2L2-      tgtggactatggtgcaacagcag--aagagctggaagctcactttcatgg

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      cttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagc
A0A2K5XSB2_MCL1-03      cttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagc
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      ctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggcc
A0A2K6AI25_BCL2L2-      ctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggcc

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      ------------------------------------ggctgtctctgaag
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      tgcatcga----------------accattagcagaaagtatcacagacg
A0A2K5XSB2_MCL1-03      tgcatcga----------------accattagcagaaagtatcacagacg
A0A2K5YR37_BCL2L1-      ------------------------------------aagggccag-gagc
A0A2K5YR37_BCL2L1-      ------------------------------------aagggccag-gagc
A0A2K5YR37_BCL2L1-      ------------------------------------aagggccag-gagc
A0A2K6AI25_BCL2L2-      --------------------------------------gcatcagtgagg
A0A2K6AI25_BCL2L2-      atcccaaaggatttgcgtatatagagttctcagacaaagagtcagtgagg
A0A2K6AI25_BCL2L2-      atcccaaaggatttgcgtatatagagttctcagacaaagagtcagtgagg

A0A2K6AD27_BCL2A1-      -------------------------------------------ggaaaat
A0A2K6AD27_BCL2A1-      -------------------------------------------gggaaat
A0A2K5XRD4_BCL2-01      actctgctcagtt------------------------------------t
A0A2K5XSB2_MCL1-02      ----------------------------------------------ggat
A0A2K5XSB2_MCL1-01      ttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
A0A2K5XSB2_MCL1-03      ttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
A0A2K5YR37_BCL2L1-      gcttcaaccgc--------------------------------------t
A0A2K5YR37_BCL2L1-      gcttcaaccgc--------------------------------------t
A0A2K5YR37_BCL2L1-      gcttcaaccgc--------------------------------------t
A0A2K6AI25_BCL2L2-      ac---------------------------------------------agt
A0A2K6AI25_BCL2L2-      acttccttggccttagatgagtccctatttagaggaaggcaaatcaaggt
A0A2K6AI25_BCL2L2-      acttccttggccttagatgagtccctatttagaggaaggcaaatcaaggt

A0A2K6AD27_BCL2A1-      ggctttgtaaagaagtttgaacctaaat----------ctggctgga---
A0A2K6AD27_BCL2A1-      ggc-------acaatcacatgcctatg-----------ctagtagag---
A0A2K5XRD4_BCL2-01      ggcc----------------------------------ctggtgggagct
A0A2K5XSB2_MCL1-02      gggtttgtggagttcttccatgtagaggacc-------tagaaggtgg--
A0A2K5XSB2_MCL1-01      gggtttgtggagttcttccatgtagaggacc-------tagaaggtgg--
A0A2K5XSB2_MCL1-03      gggtttgtggagttcttccatgtagaggacc-------tagaaggtgg--
A0A2K5YR37_BCL2L1-      ggttc---------------------------------ctgacgggca--
A0A2K5YR37_BCL2L1-      ggttc---------------------------------ctgacgggca--
A0A2K5YR37_BCL2L1-      ggttc---------------------------------ctgacgggca--
A0A2K6AI25_BCL2L2-      g-------------------------------------ctgacggggg--
A0A2K6AI25_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6AI25_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
                        *                                           *     

A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      tgca----------------------------------------------
A0A2K5XSB2_MCL1-02      -----------------------------------------------cat
A0A2K5XSB2_MCL1-01      -----------------------------------------------cat
A0A2K5XSB2_MCL1-03      -----------------------------------------------cat
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K6AI25_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc

A0A2K6AD27_BCL2A1-      --------------tgacttttctagaagttacaggaaagatctgtgaaa
A0A2K6AD27_BCL2A1-      --------------tcagtggcccacaggaagaagaaaatggctttgtaa
A0A2K5XRD4_BCL2-01      --------tcaccctgg-----------------------gtgcctatct
A0A2K5XSB2_MCL1-02      cagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtt
A0A2K5XSB2_MCL1-01      cagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtt
A0A2K5XSB2_MCL1-03      cagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtt
A0A2K5YR37_BCL2L1-      --------tgactgtggc---------------cggcgtggt-tctgctg
A0A2K5YR37_BCL2L1-      --------tgactgtggc---------------cggcgtggt-tctgctg
A0A2K5YR37_BCL2L1-      --------tgactgtggc---------------cggcgtggt-tctgctg
A0A2K6AI25_BCL2L2-      -----------ccgtggc----actgggggccctg-----gtaactgtag
A0A2K6AI25_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K6AI25_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
                                      *                              *    

A0A2K6AD27_BCL2A1-      tgctc-----------------------tctctcctgaagcaatactgtt
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      gggcc------------------------------acaagtga-------
A0A2K5XSB2_MCL1-02      tggca---------------------tatctaataaga--tagccttact
A0A2K5XSB2_MCL1-01      tggca---------------------tatctaataaga--tag-------
A0A2K5XSB2_MCL1-03      tggca---------------------tatctaataaga--tag-------
A0A2K5YR37_BCL2L1-      ggctc-------------------actcttcagtcggaaatga-------
A0A2K5YR37_BCL2L1-      ggctc-------------------actcttcagtcggaaatga-------
A0A2K5YR37_BCL2L1-      ggctc-------------------actcttcagtcggaaatga-------
A0A2K6AI25_BCL2L2-      gggcc--------------------ttttttgctagcaagtga-------
A0A2K6AI25_BCL2L2-      gggccgggctagagcgacatcatggtattccccttac---taa-------
A0A2K6AI25_BCL2L2-      gggccgggctagagcgacatcatggtattccccttac---taa-------

A0A2K6AD27_BCL2A1-      ga--
A0A2K6AD27_BCL2A1-      ----
A0A2K5XRD4_BCL2-01      ----
A0A2K5XSB2_MCL1-02      gtaa
A0A2K5XSB2_MCL1-01      ----
A0A2K5XSB2_MCL1-03      ----
A0A2K5YR37_BCL2L1-      ----
A0A2K5YR37_BCL2L1-      ----
A0A2K5YR37_BCL2L1-      ----
A0A2K6AI25_BCL2L2-      ----
A0A2K6AI25_BCL2L2-      ----
A0A2K6AI25_BCL2L2-      ----

© 1998-2023Legal notice