Dataset for CDS BAX of Organism Denticeps clupeoides

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4FPC2_BAX-01      atgacgacaggcggaagcgggcggcggcgttttcacggaaagatggccgc
A0A8C4FY48_BAX-01      atggcg------------gatcgac-------ccgccga--------cga
                       *** **            *  ** *        * * **        ** 

A0A8C4FPC2_BAX-01      gccgtcaggaggaggcgatgcggttaacagcgcagatctcctggacctca
A0A8C4FY48_BAX-01      gccgcagggagccgccggtggcggcggcggcgaggatgtggtgga-----
                       ****   ****  * ** **  *    * ***  *** *  ****     

A0A8C4FPC2_BAX-01      gcactgccctgctgaaagacttcatctacgaacgcgtccgtcgccacggg
A0A8C4FY48_BAX-01      ---------tgatgaaataataaatcaagga--gcgattgtcctgagagg
                                ** ***** * *  *** * **  ***   ***   *  **

A0A8C4FPC2_BAX-01      gacggcggtgaagttgtgttgacgagg---acccag--------------
A0A8C4FY48_BAX-01      gtatgtaatgga-taatatcaatcaggaaaacccagagctccatgttact
                       *   *   ** * *  * *  *  ***   ******              

A0A8C4FPC2_BAX-01      -ctggg----cgggggggagct---gtgcga------cccccatcacaag
A0A8C4FY48_BAX-01      cctgaggttctgggaggaaggtcgagtgagagggaagaccccatcataaa
                        *** *     *** ** ** *   *** **       ******** ** 

A0A8C4FPC2_BAX-01      aagc-tcggccagtgcctgcagcagatcggggacgagcttgatgggaacg
A0A8C4FY48_BAX-01      ggacatcgtggaccaacttattaagatttcagatgagctcaaccgcaatg
                          * ***   *    **     ****    ** *****  *  * ** *

A0A8C4FPC2_BAX-01      tgcagctgcagtgtatgattaacgacccctctctgcagcc-cactaaaga
A0A8C4FY48_BAX-01      ctgaacttcaacacctcatcaac-acggttcaaggcaactgtgcccagga
                          * ** **     * ** *** **   **   *** *    *  * **

A0A8C4FPC2_BAX-01      cactttcgtgcgggtggcttgcgagatcttctcggacgggaagtttaact
A0A8C4FY48_BAX-01      tgtgttcgtcactgttgctcggagcatctttgcagacggca---taaact
                           *****    ** *** *    *****  * ***** *   * ****

A0A8C4FPC2_BAX-01      ggggcagggtggtggcgctcttttactttgcctgtcgaatggtcatcaag
A0A8C4FY48_BAX-01      ggggccgagtggttgctctgtttcacctcgcatataagctcatttacaag
                       ***** * ***** ** ** *** ** * ** * *    *  *   ****

A0A8C4FPC2_BAX-01      gccttggtgaccaagatcccc---gacatcattagaaccatcatctcctg
A0A8C4FY48_BAX-01      gc---gctgacacagaaccactttgaaatcattcagcggattatcagctg
                       **   * ****  *** ** *   ** ******      ** ***  ***

A0A8C4FPC2_BAX-01      gacggtggactacctgcgcgatcacgtcatcaattggatcagggatcagg
A0A8C4FY48_BAX-01      ggtgcttcagttcatcagggagaacatcatcagctggcttcgccagcagg
                       *  * *  * * * *  * **  ** ******  *** *  *  * ****

A0A8C4FPC2_BAX-01      ggggctgggagggcatttggtc--ccatttcggcaccccgacatggcaga
A0A8C4FY48_BAX-01      gaggatgggtggg--tgtgatcagccgtgtaaaccac------tggtata
                       * ** **** ***  * ** **  ** * *   *  *      *** * *

A0A8C4FPC2_BAX-01      cagtcggcgtcttcctcgctggggtcctcaccactgtgattgtcatccgc
A0A8C4FY48_BAX-01      ctctgtccatcctggctgctgtagcatttgtcactgcggtgatttactgg
                       *  *   * ** *    ****  *   *   ***** * *  *   * * 

A0A8C4FPC2_BAX-01      aagatg------tga
A0A8C4FY48_BAX-01      agaagaaaccgttga
                       *  *        ***

© 1998-2023Legal notice