Dataset for CDS BAX of Organism Denticeps clupeoides

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C4FPC2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Denticeps clupeoides GN=BAX (length=621 residues).
atgacgacaggcggaagcgggcggcggcgttttcacggaaagatggccgcgccgtcaggaggaggcgatgcggttaacag
cgcagatctcctggacctcagcactgccctgctgaaagacttcatctacgaacgcgtccgtcgccacggggacggcggtg
aagttgtgttgacgaggacccagctgggcgggggggagctgtgcgacccccatcacaagaagctcggccagtgcctgcag
cagatcggggacgagcttgatgggaacgtgcagctgcagtgtatgattaacgacccctctctgcagcccactaaagacac
tttcgtgcgggtggcttgcgagatcttctcggacgggaagtttaactggggcagggtggtggcgctcttttactttgcct
gtcgaatggtcatcaaggccttggtgaccaagatccccgacatcattagaaccatcatctcctggacggtggactacctg
cgcgatcacgtcatcaattggatcagggatcaggggggctgggagggcatttggtcccatttcggcaccccgacatggca
gacagtcggcgtcttcctcgctggggtcctcaccactgtgattgtcatccgcaagatgtga
>gnl|bcl2dbcds|A0A8C4FY48_BAX-01 BCL2-associated X gene OS=[Eukaryota] Denticeps clupeoides GN=BAX (length=606 residues).
atggcggatcgacccgccgacgagccgcagggagccgccggtggcggcggcggcgaggatgtggtggatgatgaaataat
aaatcaaggagcgattgtcctgagagggtatgtaatggataatatcaatcaggaaaacccagagctccatgttactcctg
aggttctgggaggaaggtcgagtgagagggaagaccccatcataaaggacatcgtggaccaacttattaagatttcagat
gagctcaaccgcaatgctgaacttcaacacctcatcaacacggttcaaggcaactgtgcccaggatgtgttcgtcactgt
tgctcggagcatctttgcagacggcataaactggggccgagtggttgctctgtttcacctcgcatataagctcatttaca
aggcgctgacacagaaccactttgaaatcattcagcggattatcagctgggtgcttcagttcatcagggagaacatcatc
agctggcttcgccagcagggaggatgggtgggtgtgatcagccgtgtaaaccactggtatactctgtccatcctggctgc
tgtagcatttgtcactgcggtgatttactggagaagaaaccgttga
© 1998-2023Legal notice