Dataset for CDS MCL-1 of organism Scophthalmus maximus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2U9CJ81_MCL1-01      atgaatatcattccttccacaaagcgggccgccttcaacgttacgaccgg
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
                                                                          

A0A2U9CJ81_MCL1-01      agtcatgggctgcctcattcttcctcaaaatggagtcgtggagggagcga
A0A8D3B2J3_MCL1-05      ----atgggctgcctcattcttcctcaaaatggagtcgtggagggagcga
A0A8D3B2J3_MCL1-03      ----atgggctgcctcattcttcctcaaaatggagtcgtggagggagcga
A0A8D3B2J3_MCL1-04      ----atgggctgcctcattcttcctcaaaatggagtcgtggagggagcga
A0A8D3B2J3_MCL1-01      ----atgggctgcctcattcttcctcaaaatggagtcgtggagggagcga
A0A8D3B2J3_MCL1-02      ----atgggctgcctcattcttcctcaaaatggagtcgtggagggagcga
                            **********************************************

A0A2U9CJ81_MCL1-01      tgcactacggctcaggaaattccttgccgcagatcgccgtgggctccgtg
A0A8D3B2J3_MCL1-05      tgcactacggctcaggaaattccttgccgcagatcgccgtgggctccatg
A0A8D3B2J3_MCL1-03      tgcactacggctcaggaaattccttgccgcagatcgccgtgggctccatg
A0A8D3B2J3_MCL1-04      tgcactacggctcaggaaattccttgccgcagatcgccgtgggctccatg
A0A8D3B2J3_MCL1-01      tgcactacggctcaggaaattccttgccgcagatcgccgtgggctccatg
A0A8D3B2J3_MCL1-02      tgcactacggctcaggaaattccttgccgcagatcgccgtgggctccatg
                        *********************************************** **

A0A2U9CJ81_MCL1-01      atcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcc
A0A8D3B2J3_MCL1-05      atcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcc
A0A8D3B2J3_MCL1-03      atcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcc
A0A8D3B2J3_MCL1-04      atcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcc
A0A8D3B2J3_MCL1-01      atcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcc
A0A8D3B2J3_MCL1-02      atcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcc
                        **************************************************

A0A2U9CJ81_MCL1-01      caagaacctccaggtctccgcaacgaaggcgtacgcggccaagagctgcc
A0A8D3B2J3_MCL1-05      caagaacctccaggtctccgcaacgaaggcgtacgcggccaagagctgcc
A0A8D3B2J3_MCL1-03      caagaacctccaggtctccgcaacgaaggcgtacgcggccaagagctgcc
A0A8D3B2J3_MCL1-04      caagaacctccaggtctccgcaacgaaggcgtacgcggccaagagctgcc
A0A8D3B2J3_MCL1-01      caagaacctccaggtctccgcaacgaaggcgtacgcggccaagagctgcc
A0A8D3B2J3_MCL1-02      caagaacctccaggtctccgcaacgaaggcgtacgcggccaagagctgcc
                        **************************************************

A0A2U9CJ81_MCL1-01      gggaggacggcggcggcggcggcgacgtcggcggcggctctctgccctcc
A0A8D3B2J3_MCL1-05      gggaggacggcggcggcggcggcgacgtcggcggcggctctctgccctcc
A0A8D3B2J3_MCL1-03      gggaggacggcggcggcggcggcgacgtcggcggcggctctctgccctcc
A0A8D3B2J3_MCL1-04      gggaggacggcggcggcggcggcgacgtcggcggcggctctctgccctcc
A0A8D3B2J3_MCL1-01      gggaggacggcggcggcggcggcgacgtcggcggcggctctctgccctcc
A0A8D3B2J3_MCL1-02      gggaggacggcggcggcggcggcgacgtcggcggcggctctctgccctcc
                        **************************************************

A0A2U9CJ81_MCL1-01      accccggagtcggacggcgagcacgacgtctccggttgtccggcggcgga
A0A8D3B2J3_MCL1-05      accccggagtcggacggcgagcacgacgtctccggttgtccggcggcgga
A0A8D3B2J3_MCL1-03      accccggagtcggacggcgagcacgacgtctccggttgtccggcggcgga
A0A8D3B2J3_MCL1-04      accccggagtcggacggcgagcacgacgtctccggttgtccggcggcgga
A0A8D3B2J3_MCL1-01      accccggagtcggacggcgagcacgacgtctccggttgtccggcggcgga
A0A8D3B2J3_MCL1-02      accccggagtcggacggcgagcacgacgtctccggttgtccggcggcgga
                        **************************************************

A0A2U9CJ81_MCL1-01      cgaggcgctggacagcttcaccagggaactcattagccagttcctgagag
A0A8D3B2J3_MCL1-05      cgaggcgctggacagcttcaccagggaactcattagccagttcctgagag
A0A8D3B2J3_MCL1-03      cgaggcgctggacagcttcaccagggaactcattagccagttcctgagag
A0A8D3B2J3_MCL1-04      cgaggcgctggacagcttcaccagggaactcattagccagttcctgagag
A0A8D3B2J3_MCL1-01      cgaggcgctggacagcttcaccagggaactcattagccagttcctgagag
A0A8D3B2J3_MCL1-02      cgaggcgctggacagcttcaccagggaactcattagccagttcctgagag
                        **************************************************

A0A2U9CJ81_MCL1-01      actatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtcc
A0A8D3B2J3_MCL1-05      actatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtcc
A0A8D3B2J3_MCL1-03      actatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtcc
A0A8D3B2J3_MCL1-04      actatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtcc
A0A8D3B2J3_MCL1-01      actatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtcc
A0A8D3B2J3_MCL1-02      actatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtcc
                        **************************************************

A0A2U9CJ81_MCL1-01      acgatgaagagagtggtggaccgactggtggagaagcacagatacgcata
A0A8D3B2J3_MCL1-05      acgatgaagagagtggtggaccgactggtggagaagcacagatacgcata
A0A8D3B2J3_MCL1-03      acgatgaagagagtggtggaccgactggtggagaagcacagatacgcata
A0A8D3B2J3_MCL1-04      acgatgaagagagtggtggaccgactggtggagaagcacagatacgcata
A0A8D3B2J3_MCL1-01      acgatgaagagagtggtggaccgactggtggagaagcacagatacgcata
A0A8D3B2J3_MCL1-02      acgatgaagagagtggtggaccgactggtggagaagcacagatacgcata
                        **************************************************

A0A2U9CJ81_MCL1-01      caacggtatgatgaatagactgtccttggacaacagaagggacgatgtga
A0A8D3B2J3_MCL1-05      caacggtatgatgaatagactgtccttggacaacagaagggacgatgtga
A0A8D3B2J3_MCL1-03      caacggtatgatgaatagactgtccttggacaacagaagggacgatgtga
A0A8D3B2J3_MCL1-04      caacggtatgatgaatagactgtccttggacaacagaagggacgatgtga
A0A8D3B2J3_MCL1-01      caacggtatgatgaatagactgtccttggacaacagaagggacgatgtga
A0A8D3B2J3_MCL1-02      caacggtatgatgaatagactgtccttggacaacagaagggacgatgtga
                        **************************************************

A0A2U9CJ81_MCL1-01      cgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaac
A0A8D3B2J3_MCL1-05      cgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaac
A0A8D3B2J3_MCL1-03      cgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaac
A0A8D3B2J3_MCL1-04      cgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaac
A0A8D3B2J3_MCL1-01      cgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaac
A0A8D3B2J3_MCL1-02      cgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaac
                        **************************************************

A0A2U9CJ81_MCL1-01      tggggccgcgtctccagcctggtggcgttcggggccgtggtgagtcagca
A0A8D3B2J3_MCL1-05      tggggccgcgtctccagcctggtggcgttcggggccgtggtgagtcagca
A0A8D3B2J3_MCL1-03      tggggccgcgtctccagcctggtggcgttcggggccgtggtgagtcagca
A0A8D3B2J3_MCL1-04      tggggccgcgtctccagcctggtggcgttcggggccgtggtgagtcagca
A0A8D3B2J3_MCL1-01      tggggccgcgtctccagcctggtggcgttcggggccgtggtgagtcagca
A0A8D3B2J3_MCL1-02      tggggccgcgtctccagcctggtggcgttcggggccgtggtgagtcagca
                        **************************************************

A0A2U9CJ81_MCL1-01      cctgaaggagacgggcagggggaactgcgtggagctcgtcgggcaggaga
A0A8D3B2J3_MCL1-05      cctgaaggagacgggcagggggaactgcgtggagctcgtcgggcaggaga
A0A8D3B2J3_MCL1-03      cctgaaggagacgggcagggggaactgcgtggagctcgtcgggcaggaga
A0A8D3B2J3_MCL1-04      cctgaaggagacgggcagggggaactgcgtggagctcgtcgggcaggaga
A0A8D3B2J3_MCL1-01      cctgaaggagacgggcagggggaactgcgtggagctcgtcgggcaggaga
A0A8D3B2J3_MCL1-02      cctgaaggagacgggcagggggaactgcgtggagctcgtcgggcaggaga
                        **************************************************

A0A2U9CJ81_MCL1-01      tctccacatacctgctgacggaccagcgagactggctggtgaaaaacaac
A0A8D3B2J3_MCL1-05      tctccacatacctgctgacggaccagcgagactggctggtgaaaaacaac
A0A8D3B2J3_MCL1-03      tctccacatacctgctgacggaccagcgagactggctggtgaaaaacaac
A0A8D3B2J3_MCL1-04      tctccacatacctgctgacggaccagcgagactggctggtgaaaaacaac
A0A8D3B2J3_MCL1-01      tctccacatacctgctgacggaccagcgagactggctggtgaaaaacaac
A0A8D3B2J3_MCL1-02      tctccacatacctgctgacggaccagcgagactggctggtgaaaaacaac
                        **************************************************

A0A2U9CJ81_MCL1-01      tcctgggagggctttgtggaatttttccgagtagcagacccagagacgac
A0A8D3B2J3_MCL1-05      tcctgggagggctttgtggaatttttccgagtagcagacccagagacgac
A0A8D3B2J3_MCL1-03      tcctgggagggctttgtggaatttttccgagtagcagacccagagacgac
A0A8D3B2J3_MCL1-04      tcctgggagggctttgtggaatttttccgagtagcagacccagagacgac
A0A8D3B2J3_MCL1-01      tcctgggagggctttgtggaatttttccgagtagcagacccagagacgac
A0A8D3B2J3_MCL1-02      tcctgggagggctttgtggaatttttccgagtagcagacccagagacgac
                        **************************************************

A0A2U9CJ81_MCL1-01      aatgaggaacacactgattggccttgctggatttgctggtgttggggcga
A0A8D3B2J3_MCL1-05      aatgaggaacacactgattggccttgctggatttgctggtgttggggcga
A0A8D3B2J3_MCL1-03      aatgaggaacacactgattggccttgctggatttgctggtgttggggcga
A0A8D3B2J3_MCL1-04      aatgaggaacacactgattggccttgctggatttgctggtgttggggcga
A0A8D3B2J3_MCL1-01      aatgaggaacacactgattggccttgctggatttgctggtgttggggcga
A0A8D3B2J3_MCL1-02      aatgaggaacacactgattggccttgctggatttgctggtgttggggcga
                        **************************************************

A0A2U9CJ81_MCL1-01      cactggccctgttgatcagg------------------------------
A0A8D3B2J3_MCL1-05      cactggccctgttgatcagctgcagcagtgcaaatcgtctgttggggctg
A0A8D3B2J3_MCL1-03      cactggccctgttgatcagtggg---------------------------
A0A8D3B2J3_MCL1-04      cactggccctgttgatcagggac---------------------------
A0A8D3B2J3_MCL1-01      cactggccctgttgatcaggagg---------------------------
A0A8D3B2J3_MCL1-02      cactggccctgttgatcagg------------------------------
                        *******************                               

A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      cacaaacatgccaacaaattttcagtggatcttgcagcatcagtgaagca
A0A8D3B2J3_MCL1-03      -----ac----------------tctgactttcgctacatccg-------
A0A8D3B2J3_MCL1-04      -----acgtgttcatcgctccaaagtgacctccaaccaacaag-------
A0A8D3B2J3_MCL1-01      -----at-------------------------------------------
A0A8D3B2J3_MCL1-02      ------c-------------------------------------------
                                                                          

A0A2U9CJ81_MCL1-01      -------------------------------------------tga
A0A8D3B2J3_MCL1-05      gtgcggcctggaaccccatagcttgcagaaacccttcagcaggtga
A0A8D3B2J3_MCL1-03      cttctcctccaag--------ctgcgtaaaaaaatgccagcgctga
A0A8D3B2J3_MCL1-04      gcacattccaaagattttcagtttgcaaaacagaaggatcctctga
A0A8D3B2J3_MCL1-01      -----tgctgagg----------------------------cctga
A0A8D3B2J3_MCL1-02      -----tcctgtgg------------------------------taa
                                                                   * *

© 1998-2023Legal notice