Dataset for CDS Unclassified of organism Aphidius gifuensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A834Y3L1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Aphidius gifuensis (length=810 residues).
atggccggtgacagtacaaggaacaatgagattggtggggatgacgatcagggtgcgtcagcacggggggaaccacattc
cagagtgggcggcattctggaatgtgatccccccggtaacaggaatttgctgaacagcgaacagccaacaactgagatca
ctgacggtgtctgccgctatggtgccagtggtacttcatctggaatgtctttcattgaaatttgtcagatacgattacaa
catttatttcctcaacttgcaccaccatcacgttatgccattagtgatgattcagttgagatgacagccgagtgtttagc
aaatgatgttataagatatttattaaaagaagatatgtatttaatatcaagagatccaacatcacgtagtatgcgtcata
atgtttatcaaatgctcaataaacatagcatattatttacaagtatggttaatcgactgaatgttgtacctgacacagca
tatgaatcatttactggtgttgctgatgaattatttttacatggtggtataacatgggctagaattgtttgtctatatgc
atttatgggaagacttgcattgtgggctagagatggtaaaatgaatgcattaaaaaaaaaattaccacattatgtatcga
gatatattagtgaagaaattgcacattttatcaaaggatatggtggatgggaacaactttgtatagagtatccagttgat
gaggaagtcagtggtgcagtatggagaagtcttttgatgactggtgcaacacttagtcttgtcgcaacaattttaactgt
gacatcttga
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice