Dataset for CDS MCL-1 of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A096MRS6_MCL1-04      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A096MRS6_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A096MRS6_MCL1-02      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A096MRS6_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg

A0A096MRS6_MCL1-04      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A096MRS6_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A096MRS6_MCL1-02      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A096MRS6_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc

A0A096MRS6_MCL1-04      ggcttttagctacggagaaggaggcctcggcccggcgagagataggggga
A0A096MRS6_MCL1-01      ggcttttagctacggagaaggaggcctcggcccggcgagagataggggga
A0A096MRS6_MCL1-02      ggcttttagctacggagaaggaggcctcggcccggcgagagataggggga
A0A096MRS6_MCL1-03      ggctttta------------------------------------------

A0A096MRS6_MCL1-04      ggggaggccggcacggtgattggcggaagcgccggcgcaagccccccggc
A0A096MRS6_MCL1-01      ggggaggccggcacggtgattggcggaagcgccggcgcaagccccccggc
A0A096MRS6_MCL1-02      ggggaggccggcacggtgattggcggaagcgccggcgcaagccccccggc
A0A096MRS6_MCL1-03      --------------------------------------------------

A0A096MRS6_MCL1-04      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A096MRS6_MCL1-01      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A096MRS6_MCL1-02      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A096MRS6_MCL1-03      --------------------------------------------------

A0A096MRS6_MCL1-04      cggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctttgcg
A0A096MRS6_MCL1-01      cggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctttgcg
A0A096MRS6_MCL1-02      cggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctttgcg
A0A096MRS6_MCL1-03      --------------------------------------------------

A0A096MRS6_MCL1-04      cccacccgccgcgcggcgccgcttgaggagatggaagccccggctgccga
A0A096MRS6_MCL1-01      cccacccgccgcgcggcgccgcttgaggagatggaagccccggctgccga
A0A096MRS6_MCL1-02      cccacccgccgcgcggcgccgcttgaggagatggaagccccggctgccga
A0A096MRS6_MCL1-03      --------------------------------------------------

A0A096MRS6_MCL1-04      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A096MRS6_MCL1-01      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A096MRS6_MCL1-02      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A096MRS6_MCL1-03      --------------------------------------------------

A0A096MRS6_MCL1-04      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A096MRS6_MCL1-01      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A096MRS6_MCL1-02      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A096MRS6_MCL1-03      --------------------------------------------------

A0A096MRS6_MCL1-04      ggtaatagccccagtacggatgggtcactaccctcgacgccgccgccagc
A0A096MRS6_MCL1-01      ggtaatagccccagtacggatgggtcactaccctcgacgccgccgccagc
A0A096MRS6_MCL1-02      ggtaatagccccagtacggatgggtcactaccctcgacgccgccgccagc
A0A096MRS6_MCL1-03      --------------------------------------------------

A0A096MRS6_MCL1-04      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctt
A0A096MRS6_MCL1-01      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctt
A0A096MRS6_MCL1-02      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctt
A0A096MRS6_MCL1-03      --------------------------------------------------

A0A096MRS6_MCL1-04      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
A0A096MRS6_MCL1-01      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
A0A096MRS6_MCL1-02      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
A0A096MRS6_MCL1-03      -----------------gccaccggcgccaaggacacaaagccaatgggc

A0A096MRS6_MCL1-04      aggtctggggccaccagcaggaaggctctggagaccttacgacgggttgg
A0A096MRS6_MCL1-01      aggtctggggccaccagcaggaaggctctggagaccttacgacgggttgg
A0A096MRS6_MCL1-02      aggtctggggccaccagcaggaaggctctggagaccttacgacgggttgg
A0A096MRS6_MCL1-03      aggtctggggccaccagcaggaaggctctggagaccttacgacgggttgg

A0A096MRS6_MCL1-04      ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A096MRS6_MCL1-01      ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A096MRS6_MCL1-02      ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A096MRS6_MCL1-03      ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga

A0A096MRS6_MCL1-04      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A096MRS6_MCL1-01      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A096MRS6_MCL1-02      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A096MRS6_MCL1-03      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg

A0A096MRS6_MCL1-04      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A096MRS6_MCL1-01      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A096MRS6_MCL1-02      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A096MRS6_MCL1-03      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct

A0A096MRS6_MCL1-04      catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
A0A096MRS6_MCL1-01      catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
A0A096MRS6_MCL1-02      catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
A0A096MRS6_MCL1-03      catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag

A0A096MRS6_MCL1-04      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A096MRS6_MCL1-01      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A096MRS6_MCL1-02      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A096MRS6_MCL1-03      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg

A0A096MRS6_MCL1-04      acaaaacgggactggctagttaaacaaagaggctgggctattttttgttc
A0A096MRS6_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggg------------
A0A096MRS6_MCL1-02      acaaaacgggactggctagttaaacaaagaggctgggatgggttt-----
A0A096MRS6_MCL1-03      acaaaacgggactggctagttaaacaaagaggctgggatgggttt-----

A0A096MRS6_MCL1-04      cagttcagttgaatactc---ttcagtggattcaaaccatga----agaa
A0A096MRS6_MCL1-01      ----------------------------------------------aaaa
A0A096MRS6_MCL1-02      -------gtggagttcttccatgtagaggacctagaaggtggcatcagaa
A0A096MRS6_MCL1-03      -------gtggagttcttccatgtagaggacctagaaggtggcatcagaa
                                                                      * **

A0A096MRS6_MCL1-04      ataagtcaccag-----gggaggatagctgaaat-------------aca
A0A096MRS6_MCL1-01      acatgcagtcctctagtgttcatgt----------------------gca
A0A096MRS6_MCL1-02      atgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggca
A0A096MRS6_MCL1-03      atgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggca
                        *   *            *      *                       **

A0A096MRS6_MCL1-04      ttcctaa--------
A0A096MRS6_MCL1-01      t-tctgtgggggtga
A0A096MRS6_MCL1-02      tatctaataagatag
A0A096MRS6_MCL1-03      tatctaataagatag
                        *  **          

© 1998-2023Legal notice