Dataset for CDS BCL-2-like of organism Pseudonaja textilis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A670Z9Y4_BCL2L1-      atgtcgagcggcaaccggtccctggtggtggacttcattgcctacaagct
A0A670Z5Q4_MCL1-01      ------------------------------------------tgtgaaag
A0A670YDS2_BCL2A1-      at---ggaaagctacaatttcctttatgtgaacaccttgg--tgcaagat
A0A670ZV01_BCL2-01      at----gatggct-------------------catcctgggataagagat
                                                                  *   *   

A0A670Z9Y4_BCL2L1-      ggc--------------gcagcggggccacagctggcgcgagatcgaggg
A0A670Z5Q4_MCL1-01      tat-----------------------------------------------
A0A670YDS2_BCL2A1-      tac------------------ctgaaatacatttgtcaaga---------
A0A670ZV01_BCL2-01      tacagtaaccgggagatagtgctgaggtacatccattacaagct-----g

A0A670Z9Y4_BCL2L1-      ggacggcgaggagcggacggagctgtccggcgagatgggcagcggcagcg
A0A670Z5Q4_MCL1-01      ----------------------caggc----------tgcagcagaaagg
A0A670YDS2_BCL2A1-      ---------------ggctcagctggc----------agcggccccaaac
A0A670ZV01_BCL2-01      tcacagaaaggatatgactgggttgcc----------agtggagacagag
                                                * *           *  *    *   

A0A670Z9Y4_BCL2L1-      gcggcg--tcctgaacggcgggag------------cccctc--------
A0A670Z5Q4_MCL1-01      aaactgcactttgtactgtgggggaggggggggcaaccttgc--------
A0A670YDS2_BCL2A1-      aaagtg-----------gctgaag------------tccttc--------
A0A670ZV01_BCL2-01      aaaacgtttctcctgctgttggga------------cctttcctgccctt
                             *           *  *                *   *        

A0A670Z9Y4_BCL2L1-      ------ctggcaccccagccccagcccggtggt--caacggggcggccag
A0A670Z5Q4_MCL1-01      ---aggcaggtccccctccccccatttgcaggaaatgaccagacaa-aa-
A0A670YDS2_BCL2A1-      gtaaagccgg-------atcttctgct--cagaaagaagttgaaggcaa-
A0A670ZV01_BCL2-01      ggaggactggtgcctctgccttctgctgctgttagtaacttggctgcca-
                              * **         *                 *   *      * 

A0A670Z9Y4_BCL2L1-      cattcacccggccctgctggaagagctgagcgacggcccccaggaggcgg
A0A670Z5Q4_MCL1-01      ----------------ccaggatacgt-----ttgtcccctctttgacct
A0A670YDS2_BCL2A1-      ----------------cctgaggcctt-----acgtggactcactgggga
A0A670ZV01_BCL2-01      ----------------ctgaagaacat-----cc-tgtaccc-caagttg
                                        *         *            *          

A0A670Z9Y4_BCL2L1-      tgaggcagacgctgcgggaagccggggacgagttcgaactgcgctaccgg
A0A670Z5Q4_MCL1-01      tctgtggtgctttgcctaaagtcctt------ccttcccttcttaattca
A0A670YDS2_BCL2A1-      ttcattcca---tagaagaagctggcaac--attttcc-------atcaa
A0A670ZV01_BCL2-01      tttattccacactatgccaagctggtgatgagttttcccggaggtatcaa
                        *           *     ***                        *    

A0A670Z9Y4_BCL2L1-      cgggcctttagcgacctgacctcgcagctccacatcaccctgggcacggc
A0A670Z5Q4_MCL1-01      ggaa------------tgctgaggaaagtgcagatcgacaaagcggatga
A0A670YDS2_BCL2A1-      gtga----------------tggaaaa----------------tgaat--
A0A670ZV01_BCL2-01      agggactttacccagatgtctggacaactgcacttgactccagtgactgc

A0A670Z9Y4_BCL2L1-      ttaccagagctttgagcaggtggtcaacgaacttttccgggacgg---gg
A0A670Z5Q4_MCL1-01      cttgaagcttatgtcggaagttgcaacgcaggttttcaacgatggcataa
A0A670YDS2_BCL2A1-      --------------------ttgcggatggg------------aa---aa
A0A670ZV01_BCL2-01      cagaagtcatttcatggctgttgtggaagagctgttccgagatgg---ag
                                            * *                           

A0A670Z9Y4_BCL2L1-      tgaactgggggcggattgtggcctttttctccttcggaggggccctgtgc
A0A670Z5Q4_MCL1-01      caaactgggggcgaattgtgactctcatttcttttggtgcctttgttgcc
A0A670YDS2_BCL2A1-      ttaactggggacgcattctgacgatattcctattcggtggaatcctggcc
A0A670ZV01_BCL2-01      taaattggggaaggattgtggcattctttgaatttggtggcatgctgtgt
                          ** *****  * *** ** *  *  *    ** ** *      *    

A0A670Z9Y4_BCL2L1-      gtggag----agcg---tcgacaaggagatgcggggcctggtgggaagga
A0A670Z5Q4_MCL1-01      aaacacttgaagagcataaatcaagaaagcggca-------tcagcactt
A0A670YDS2_BCL2A1-      aaaaaactccaagg---acctttggcaaaagaaaact----tgaaacaga
A0A670ZV01_BCL2-01      gtggaa----agtg---tcagtcgggagatgtcacctctggtggacagta
                            *     *  *          * *   *          *        

A0A670Z9Y4_BCL2L1-      tcgccacctggatggccacctacctgacggagcacctggacccctggatt
A0A670Z5Q4_MCL1-01      tggcggagatcatcacggaggtgctggtgacagagaagagagagtggctg
A0A670YDS2_BCL2A1-      tctcctatttcatcacagactatattgtgagcaccaaaggaaagtggatc
A0A670ZV01_BCL2-01      ttgctgaatggatgactgaatacatgaacaggcacctgcataattggatc
                        *  *       **  *        *                   *** * 

A0A670Z9Y4_BCL2L1-      caagacaacggcggctggg--taagtctc---------------------
A0A670Z5Q4_MCL1-01      ctgcatcacaacgcctggg---agggctttgttaaattcttccatgtaga
A0A670YDS2_BCL2A1-      agtgagaatggaggatgggacaatggctt---------------tataac
A0A670ZV01_BCL2-01      caggacaatggaggctggg---atgcctt---------------tgt---
                            *  *    *  ****   * * **                      

A0A670Z9Y4_BCL2L1-      --------------------------------------------------
A0A670Z5Q4_MCL1-01      ggacctggaaggcagcatcagaaacattctggtggcttttgcgg------
A0A670YDS2_BCL2A1-      aaaatttgaggataga------aactcctgggtatccttatctactctga
A0A670ZV01_BCL2-01      ggagctgtacagcaac------aacattagg---cctttgtttgatttg-

A0A670Z9Y4_BCL2L1-      ------------gggctaaacttg--------------------------
A0A670Z5Q4_MCL1-01      ---------gcgtggctggcctaggag-cgagctt---------------
A0A670YDS2_BCL2A1-      agacaaagatcttggctgtttttt----caatcttcaat-----------
A0A670ZV01_BCL2-01      ---------tcatggctgcctctgaagacgatccttagtctggcagtggt

A0A670Z9Y4_BCL2L1-      ----------------------------------caaggttga
A0A670Z5Q4_MCL1-01      ---------------------ggcttacttgatcc---ggtga
A0A670YDS2_BCL2A1-      ------caatatcact------------------cataa----
A0A670ZV01_BCL2-01      gggcgcctgcatcacgctgggggcttacctgggacataagtga

© 1998-2021Legal notice