Dataset for CDS BCL2A1 of organism Callithrix jacchus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F7HXW0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2A1 (length=489 residues).
atgacagactctgaatttggatatattcacaatctaactcaggactatctgcagtacgtcctgcagataccacagtctgg
aatgggtccgagcaaaacgtctagagtgctacaacaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagt
catgcttggacaatgttgatattgcgtccatagataatgccagaacgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatctcacattttgttgctgagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggggaaatggcacagtctcatgcttatgctagtatcagtggcccagaagaagaggaaaatg
gctttgtaa
© 1998-2020Legal notice