Dataset for CDS MCL-1 of organism Gadus morhua

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


D2ITA0_MCL1-02      atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggttt
D2ITA0_MCL1-03      atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggttt
D2ITA0_MCL1-01      atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggttt
D2ITA0_MCL1-04      atgt--------------------------------------------------------
                    ***                                                         

D2ITA0_MCL1-02      aacagccctcaaaatggaggcgaagagcgaaacatggacttccactccgaaggttcacac
D2ITA0_MCL1-03      aacagccctcaaaatggaggcgaagagcgaaacatggacttccactccgaaggttcacac
D2ITA0_MCL1-01      aacagccctcaaaatggaggcgaagagcgaaacatggacttccactccgaaggttcacac
D2ITA0_MCL1-04      --cggacccca-----------------gggacatagac---------------------
                      * * ** **                 *  **** ***                     

D2ITA0_MCL1-02      accacgacagagggggccttgcctctaatggcgacgttcaaaagcggagacgaacgtaaa
D2ITA0_MCL1-03      accacgacagagggggccttgcctctaatggcgacgttcaaaagcggagacgaacgtaaa
D2ITA0_MCL1-01      accacgacagagggggccttgcctctaatggcgacgttcaaaagcggagacgaacgtaaa
D2ITA0_MCL1-04      ---------gaggatgccatcc---------------tcaaaggc---------------
                             ****  *** * *               ***** **               

D2ITA0_MCL1-02      ccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
D2ITA0_MCL1-03      ccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
D2ITA0_MCL1-01      ccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
D2ITA0_MCL1-04      ------------------------------------------------------------
                                                                                

D2ITA0_MCL1-02      ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccag
D2ITA0_MCL1-03      ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccag
D2ITA0_MCL1-01      ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccag
D2ITA0_MCL1-04      ---------------ctcagctctgcagagct-----------------ggaacagctgg
                                   *  *** ** * ** **                  * *****  *

D2ITA0_MCL1-02      gcgggggaagaagtgttggataacgacaccaagcgaatcattcgcatttttctcagagac
D2ITA0_MCL1-03      gcgggggaagaagtgttggataacgacaccaagcgaatcattcgcatttttctcagagac
D2ITA0_MCL1-01      gcgggggaagaagtgttggataacgacaccaagcgaatcattcgcatttttctcagagac
D2ITA0_MCL1-04      ------------------------------------------------------------
                                                                                

D2ITA0_MCL1-02      tatgcaggggcatcaaaagctaaaaggacaagacaagacgaggttcaagtgactatgaga
D2ITA0_MCL1-03      tatgcaggggcatcaaaagctaaaaggacaagacaagacgaggttcaagtgactatgaga
D2ITA0_MCL1-01      tatgcaggggcatcaaaagctaaaaggacaagacaagacgaggttcaagtgactatgaga
D2ITA0_MCL1-04      ------------------------------------------------------------
                                                                                

D2ITA0_MCL1-02      agagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
D2ITA0_MCL1-03      agagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
D2ITA0_MCL1-01      agagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
D2ITA0_MCL1-04      -------------------------------------------agtgtgagctccaggac
                                                               ** **  * ***** * 

D2ITA0_MCL1-02      ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctc
D2ITA0_MCL1-03      ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctc
D2ITA0_MCL1-01      ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctc
D2ITA0_MCL1-04      ctgg--------------------------------------------------------
                     ***                                                        

D2ITA0_MCL1-02      ttcgcagacagcacaacaaactgggggcgtatcgccagcctggtggccttcggagcagcg
D2ITA0_MCL1-03      ttcgcagacagcacaacaaactgggggcgtatcgccagcctggtggccttcggagcagcg
D2ITA0_MCL1-01      ttcgcagacagcacaacaaactgggggcgtatcgccagcctggtggccttcggagcagcg
D2ITA0_MCL1-04      ------------------------------------------------------------
                                                                                

D2ITA0_MCL1-02      ttgtgtcagtacctagaggccaggggtaaagaaggctgcgtgtcgctggtggccgaggag
D2ITA0_MCL1-03      ttgtgtcagtacctagaggccaggggtaaagaaggctgcgtgtcgctggtggccgaggag
D2ITA0_MCL1-01      ttgtgtcagtacctagaggccaggggtaaagaaggctgcgtgtcgctggtggccgaggag
D2ITA0_MCL1-04      ------------------------------------------------------------
                                                                                

D2ITA0_MCL1-02      atttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatggg--
D2ITA0_MCL1-03      atttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatggg--
D2ITA0_MCL1-01      atttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatggaat
D2ITA0_MCL1-04      -------------------------------------------------accccgagaat
                                                                     ** *   *   

D2ITA0_MCL1-02      ------------------------------------------------------------
D2ITA0_MCL1-03      ------------------------------------------------------------
D2ITA0_MCL1-01      gccatgctcccagcgggctaccggcagcgggaccagaccaagaagacccccacgggggac
D2ITA0_MCL1-04      gccatgctcccagcgggctaccggcagcgggaccagaccaagaagacccccacgggggac
                                                                                

D2ITA0_MCL1-02      -------------------agggcttcgtaga----------------------------
D2ITA0_MCL1-03      -------------------agggcttcgtaga----------------------------
D2ITA0_MCL1-01      tatgaccgcgacgccctgcaggactacctggagaagagcgccctggagcacgaggacagg
D2ITA0_MCL1-04      tatgaccgcgacgccctgcaggactacctggagaagagcgccctggagcacgaggacagg
                                       *** ** * * **                            

D2ITA0_MCL1-02      --------------------------------------------gttttttc--------
D2ITA0_MCL1-03      --------------------------------------------gttttttc--------
D2ITA0_MCL1-01      gaagacctgatccccttcaccggggagaagaaag---ggaaggcgtttgttcccacggcg
D2ITA0_MCL1-04      gaagacctgatccccttcaccggggagaagaaaggtaggaaggcgtttgttcccacggcg
                                                                **** ***        

D2ITA0_MCL1-02      ------------------------------------------------------------
D2ITA0_MCL1-03      ------------------------------------------------------------
D2ITA0_MCL1-01      accgggcagatccccctaagcgagcagatcaccctggagccggagctggaagaggccctg
D2ITA0_MCL1-04      accgggcagatccccctaagcgagcagatcaccctggagccggagctggaagaggccctg
                                                                                

D2ITA0_MCL1-02      --gagtgtca--gaccctgagac-------------------------------------
D2ITA0_MCL1-03      --gagtgtca--gaccctgagac-------------------------------------
D2ITA0_MCL1-01      aagaacgccactgacgctgagatgtgcgacatcgcagctatccttggaatgtataccctg
D2ITA0_MCL1-04      aagaacgccactgacgctgagatgtgcgacatcgcagctatccttggaatgtataccctg
                      **  * **  *** ******                                      

D2ITA0_MCL1-02      ------------------------------------------------------------
D2ITA0_MCL1-03      ------------------------------------------------------------
D2ITA0_MCL1-01      atgagcaacaagcagtactatgatgctctgggttgcacggggaagatcgccaacacggag
D2ITA0_MCL1-04      atgagcaacaagcagtactatgatgctctgggttgcacggggaagatcgccaacacggag
                                                                                

D2ITA0_MCL1-02      ------------------------------------------------------------
D2ITA0_MCL1-03      ------------------------------------------------------------
D2ITA0_MCL1-01      ggcatcaacagtgttgtaaaacaagatcccttcaagatctttccggaagagcccccaaac
D2ITA0_MCL1-04      ggcatcaacagtgttgtaaaacaagatcccttcaagatctttccggaagagcccccaaac
                                                                                

D2ITA0_MCL1-02      -----------------gaccgtg------------------------------------
D2ITA0_MCL1-03      -----------------gaccgtg------------------------------------
D2ITA0_MCL1-01      accaccaacgtggaggagaccgtggagaggatccacaacaacgacagtggtctgacggag
D2ITA0_MCL1-04      accaccaacgtggaggagaccgtggagaggatccacaacaacgacagtggtctgacggag
                                     *******                                    

D2ITA0_MCL1-02      ------------------------------------------------------------
D2ITA0_MCL1-03      ------------------------------------------------------------
D2ITA0_MCL1-01      gtcaacctcaacaacatcaaggacattcccatccccacgctgaaggaggtgtttgaggcc
D2ITA0_MCL1-04      gtcaacctcaacaacatcaaggacattcccatccccacgctgaaggaggtgtttgaggcc
                                                                                

D2ITA0_MCL1-02      ----agaaatacactcatg-----------------------------------------
D2ITA0_MCL1-03      ----agaaatacactcatg-----------------------------------------
D2ITA0_MCL1-01      atgaagggaaactcttacgttgagatcctgagcatcgcagccacacggagcaacgacccc
D2ITA0_MCL1-04      atgaagggaaactcttacgttgagatcctgagcatcgcagccacacggagcaacgacccc
                        **  * ** ** * *                                         

D2ITA0_MCL1-02      ---gcctttgc-----tggatttgctg---------------------------------
D2ITA0_MCL1-03      ---gcctttgc-----tggatttgctg---------------------------------
D2ITA0_MCL1-01      gtcgccttcgcatgtgcggagatgctgcaggagaacaccagtctccagagtcttaacatt
D2ITA0_MCL1-04      gtcgccttcgcatgtgcggagatgctgcaggagaacaccagtctccagagtcttaacatt
                       ***** **      ***  *****                                 

D2ITA0_MCL1-02      ------------------------------------------------------------
D2ITA0_MCL1-03      ------------------------------------------------------------
D2ITA0_MCL1-01      gagtctaacttcatcaccgcagagggcatgaaggctgtagtcaaggccatggccagcaac
D2ITA0_MCL1-04      gagtctaacttcatcaccgcagagggcatgaaggctgtagtcaaggccatggccagcaac
                                                                                

D2ITA0_MCL1-02      ---gtattggtgcaac--------------------------------------------
D2ITA0_MCL1-03      ---gtattggtgcaac--------------------------------------------
D2ITA0_MCL1-01      gccacgctggtggagctcaagatcgacaaccagaggcacaccctgggagactcggtggag
D2ITA0_MCL1-04      gccacgctggtggagctcaagatcgacaaccagaggcacaccctgggagactcggtggag
                           ***** * *                                            

D2ITA0_MCL1-02      -----aattgcc--------------------------------------ctactaatc-
D2ITA0_MCL1-03      -----aattgcc--------------------------------------ctactaatc-
D2ITA0_MCL1-01      atggagatcgccgccatgctggagaacaactccagcatcctgaagttcggctaccacttc
D2ITA0_MCL1-04      atggagatcgccgccatgctggagaacaactccagcatcctgaagttcggctaccacttc
                          ** ***                                      **** * *  

D2ITA0_MCL1-02      ---------aggtga---------------------------------------------
D2ITA0_MCL1-03      ---------aggtcagagggccaagtctccaggg---------agaagaacagaaattta
D2ITA0_MCL1-01      acccagcaggggccccgggcccgggccgccatggccgtcaccaggaacaacgatatgctt
D2ITA0_MCL1-04      acccagcaggggccccgggcccgggccgccatggccgtcaccaggaacaacgatatgctt
                              **                                                

D2ITA0_MCL1-02      ---------------------
D2ITA0_MCL1-03      ccccaacagacgtaa------
D2ITA0_MCL1-01      cgccaacagaggctgagatga
D2ITA0_MCL1-04      cgccaacagaggctgagatga
                                         

© 1998-2022Legal notice