Dataset for CDS MCL-1 of organism Gadus morhua

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5CE84_MCL1-02      atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagac
A0A8C5CE84_MCL1-03      atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagac
A0A8C5CE84_MCL1-01      atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagac
A0A8C5CE84_MCL1-04      atgt----------------------------------------------
                        ***                                               

A0A8C5CE84_MCL1-02      ctgctggtttaacagccctcaaaatggaggcgaagagcgaaacatggact
A0A8C5CE84_MCL1-03      ctgctggtttaacagccctcaaaatggaggcgaagagcgaaacatggact
A0A8C5CE84_MCL1-01      ctgctggtttaacagccctcaaaatggaggcgaagagcgaaacatggact
A0A8C5CE84_MCL1-04      ------------cggacccca-----------------gggacatagac-
                                    * * ** **                 *  **** *** 

A0A8C5CE84_MCL1-02      tccactccgaaggttcacacaccacgacagagggggccttgcctctaatg
A0A8C5CE84_MCL1-03      tccactccgaaggttcacacaccacgacagagggggccttgcctctaatg
A0A8C5CE84_MCL1-01      tccactccgaaggttcacacaccacgacagagggggccttgcctctaatg
A0A8C5CE84_MCL1-04      -----------------------------gaggatgccatcc--------
                                                     ****  *** * *        

A0A8C5CE84_MCL1-02      gcgacgttcaaaagcggagacgaacgtaaaccaagacccacggaactagg
A0A8C5CE84_MCL1-03      gcgacgttcaaaagcggagacgaacgtaaaccaagacccacggaactagg
A0A8C5CE84_MCL1-01      gcgacgttcaaaagcggagacgaacgtaaaccaagacccacggaactagg
A0A8C5CE84_MCL1-04      -------tcaaaggc-----------------------------------
                               ***** **                                   

A0A8C5CE84_MCL1-02      aaggggcaggctggtgaacaaatcgcaagacgaccaagaaggaaacggtt
A0A8C5CE84_MCL1-03      aaggggcaggctggtgaacaaatcgcaagacgaccaagaaggaaacggtt
A0A8C5CE84_MCL1-01      aaggggcaggctggtgaacaaatcgcaagacgaccaagaaggaaacggtt
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5CE84_MCL1-02      cgctgcctagcactccggaactccagtcagaagtagacacggacagccag
A0A8C5CE84_MCL1-03      cgctgcctagcactccggaactccagtcagaagtagacacggacagccag
A0A8C5CE84_MCL1-01      cgctgcctagcactccggaactccagtcagaagtagacacggacagccag
A0A8C5CE84_MCL1-04      -----ctcagctctgcagagct-----------------ggaacagctgg
                             *  *** ** * ** **                  * *****  *

A0A8C5CE84_MCL1-02      gcgggggaagaagtgttggataacgacaccaagcgaatcattcgcatttt
A0A8C5CE84_MCL1-03      gcgggggaagaagtgttggataacgacaccaagcgaatcattcgcatttt
A0A8C5CE84_MCL1-01      gcgggggaagaagtgttggataacgacaccaagcgaatcattcgcatttt
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5CE84_MCL1-02      tctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
A0A8C5CE84_MCL1-03      tctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
A0A8C5CE84_MCL1-01      tctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5CE84_MCL1-02      aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacac
A0A8C5CE84_MCL1-03      aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacac
A0A8C5CE84_MCL1-01      aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacac
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5CE84_MCL1-02      caatacgcatacaagggtatgatccagaaattggaattggacggccgagg
A0A8C5CE84_MCL1-03      caatacgcatacaagggtatgatccagaaattggaattggacggccgagg
A0A8C5CE84_MCL1-01      caatacgcatacaagggtatgatccagaaattggaattggacggccgagg
A0A8C5CE84_MCL1-04      -------------agtgtgagctccaggacctgg----------------
                                     ** **  * ***** *  ***                

A0A8C5CE84_MCL1-02      ggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagaca
A0A8C5CE84_MCL1-03      ggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagaca
A0A8C5CE84_MCL1-01      ggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagaca
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5CE84_MCL1-02      gcacaacaaactgggggcgtatcgccagcctggtggccttcggagcagcg
A0A8C5CE84_MCL1-03      gcacaacaaactgggggcgtatcgccagcctggtggccttcggagcagcg
A0A8C5CE84_MCL1-01      gcacaacaaactgggggcgtatcgccagcctggtggccttcggagcagcg
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5CE84_MCL1-02      ttgtgtcagtacctagaggccaggggtaaagaaggctgcgtgtcgctggt
A0A8C5CE84_MCL1-03      ttgtgtcagtacctagaggccaggggtaaagaaggctgcgtgtcgctggt
A0A8C5CE84_MCL1-01      ttgtgtcagtacctagaggccaggggtaaagaaggctgcgtgtcgctggt
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5CE84_MCL1-02      ggccgaggagatttcctcatacctcctttcagaccaacgggaatggttgg
A0A8C5CE84_MCL1-03      ggccgaggagatttcctcatacctcctttcagaccaacgggaatggttgg
A0A8C5CE84_MCL1-01      ggccgaggagatttcctcatacctcctttcagaccaacgggaatggttgg
A0A8C5CE84_MCL1-04      --------------------------------------------------
                                                                          

A0A8C5CE84_MCL1-02      tcaaaaacaactcatggg--------------------------------
A0A8C5CE84_MCL1-03      tcaaaaacaactcatggg--------------------------------
A0A8C5CE84_MCL1-01      tcaaaaacaactcatggaatgccatgctcccagcgggctaccggcagcgg
A0A8C5CE84_MCL1-04      ---------accccgagaatgccatgctcccagcgggctaccggcagcgg
                                 ** *   *                                 

A0A8C5CE84_MCL1-02      -------------------------------------------------a
A0A8C5CE84_MCL1-03      -------------------------------------------------a
A0A8C5CE84_MCL1-01      gaccagaccaagaagacccccacgggggactatgaccgcgacgccctgca
A0A8C5CE84_MCL1-04      gaccagaccaagaagacccccacgggggactatgaccgcgacgccctgca
                                                                         *

A0A8C5CE84_MCL1-02      gggcttcgtaga--------------------------------------
A0A8C5CE84_MCL1-03      gggcttcgtaga--------------------------------------
A0A8C5CE84_MCL1-01      ggactacctggagaagagcgccctggagcacgaggacagggaagacctga
A0A8C5CE84_MCL1-04      ggactacctggagaagagcgccctggagcacgaggacagggaagacctga
                        ** ** * * **                                      

A0A8C5CE84_MCL1-02      ----------------------------------gttttttc--------
A0A8C5CE84_MCL1-03      ----------------------------------gttttttc--------
A0A8C5CE84_MCL1-01      tccccttcaccggggagaagaaag---ggaaggcgtttgttcccacggcg
A0A8C5CE84_MCL1-04      tccccttcaccggggagaagaaaggtaggaaggcgtttgttcccacggcg
                                                          **** ***        

A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      accgggcagatccccctaagcgagcagatcaccctggagccggagctgga
A0A8C5CE84_MCL1-04      accgggcagatccccctaagcgagcagatcaccctggagccggagctgga
                                                                          

A0A8C5CE84_MCL1-02      ------------gagtgtca--gaccctgagac-----------------
A0A8C5CE84_MCL1-03      ------------gagtgtca--gaccctgagac-----------------
A0A8C5CE84_MCL1-01      agaggccctgaagaacgccactgacgctgagatgtgcgacatcgcagcta
A0A8C5CE84_MCL1-04      agaggccctgaagaacgccactgacgctgagatgtgcgacatcgcagcta
                                    **  * **  *** ******                  

A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      tccttggaatgtataccctgatgagcaacaagcagtactatgatgctctg
A0A8C5CE84_MCL1-04      tccttggaatgtataccctgatgagcaacaagcagtactatgatgctctg
                                                                          

A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      ggttgcacggggaagatcgccaacacggagggcatcaacagtgttgtaaa
A0A8C5CE84_MCL1-04      ggttgcacggggaagatcgccaacacggagggcatcaacagtgttgtaaa
                                                                          

A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      acaagatcccttcaagatctttccggaagagcccccaaacaccaccaacg
A0A8C5CE84_MCL1-04      acaagatcccttcaagatctttccggaagagcccccaaacaccaccaacg
                                                                          

A0A8C5CE84_MCL1-02      -------gaccgtg------------------------------------
A0A8C5CE84_MCL1-03      -------gaccgtg------------------------------------
A0A8C5CE84_MCL1-01      tggaggagaccgtggagaggatccacaacaacgacagtggtctgacggag
A0A8C5CE84_MCL1-04      tggaggagaccgtggagaggatccacaacaacgacagtggtctgacggag
                               *******                                    

A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      gtcaacctcaacaacatcaaggacattcccatccccacgctgaaggaggt
A0A8C5CE84_MCL1-04      gtcaacctcaacaacatcaaggacattcccatccccacgctgaaggaggt
                                                                          

A0A8C5CE84_MCL1-02      --------------agaaatacactcatg---------------------
A0A8C5CE84_MCL1-03      --------------agaaatacactcatg---------------------
A0A8C5CE84_MCL1-01      gtttgaggccatgaagggaaactcttacgttgagatcctgagcatcgcag
A0A8C5CE84_MCL1-04      gtttgaggccatgaagggaaactcttacgttgagatcctgagcatcgcag
                                      **  * ** ** * *                     

A0A8C5CE84_MCL1-02      -----------------------gcctttgc-----tggatttgctg---
A0A8C5CE84_MCL1-03      -----------------------gcctttgc-----tggatttgctg---
A0A8C5CE84_MCL1-01      ccacacggagcaacgaccccgtcgccttcgcatgtgcggagatgctgcag
A0A8C5CE84_MCL1-04      ccacacggagcaacgaccccgtcgccttcgcatgtgcggagatgctgcag
                                               ***** **      ***  *****   

A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      gagaacaccagtctccagagtcttaacattgagtctaacttcatcaccgc
A0A8C5CE84_MCL1-04      gagaacaccagtctccagagtcttaacattgagtctaacttcatcaccgc
                                                                          

A0A8C5CE84_MCL1-02      -------------------------------------------gtattgg
A0A8C5CE84_MCL1-03      -------------------------------------------gtattgg
A0A8C5CE84_MCL1-01      agagggcatgaaggctgtagtcaaggccatggccagcaacgccacgctgg
A0A8C5CE84_MCL1-04      agagggcatgaaggctgtagtcaaggccatggccagcaacgccacgctgg
                                                                       ***

A0A8C5CE84_MCL1-02      tgcaac--------------------------------------------
A0A8C5CE84_MCL1-03      tgcaac--------------------------------------------
A0A8C5CE84_MCL1-01      tggagctcaagatcgacaaccagaggcacaccctgggagactcggtggag
A0A8C5CE84_MCL1-04      tggagctcaagatcgacaaccagaggcacaccctgggagactcggtggag
                        ** * *                                            

A0A8C5CE84_MCL1-02      -----aattgcc--------------------------------------
A0A8C5CE84_MCL1-03      -----aattgcc--------------------------------------
A0A8C5CE84_MCL1-01      atggagatcgccgccatgctggagaacaactccagcatcctgaagttcgg
A0A8C5CE84_MCL1-04      atggagatcgccgccatgctggagaacaactccagcatcctgaagttcgg
                              ** ***                                      

A0A8C5CE84_MCL1-02      ctactaatc----------aggtga-------------------------
A0A8C5CE84_MCL1-03      ctactaatc----------aggtcagagggccaagtctccaggg------
A0A8C5CE84_MCL1-01      ctaccacttcacccagcaggggccccgggcccgggccgccatggccgtca
A0A8C5CE84_MCL1-04      ctaccacttcacccagcaggggccccgggcccgggccgccatggccgtca
                        **** * *            **                            

A0A8C5CE84_MCL1-02      -----------------------------------------
A0A8C5CE84_MCL1-03      ---agaagaacagaaatttaccccaacagacgtaa------
A0A8C5CE84_MCL1-01      ccaggaacaacgatatgcttcgccaacagaggctgagatga
A0A8C5CE84_MCL1-04      ccaggaacaacgatatgcttcgccaacagaggctgagatga
                                                                 

© 1998-2022Legal notice