Dataset for CDS MCL-1 of organism Gadus morhua

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|D2ITA0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=1638 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatggaat
gccatgctcccagcgggctaccggcagcgggaccagaccaagaagacccccacgggggactatgaccgcgacgccctgca
ggactacctggagaagagcgccctggagcacgaggacagggaagacctgatccccttcaccggggagaagaaagggaagg
cgtttgttcccacggcgaccgggcagatccccctaagcgagcagatcaccctggagccggagctggaagaggccctgaag
aacgccactgacgctgagatgtgcgacatcgcagctatccttggaatgtataccctgatgagcaacaagcagtactatga
tgctctgggttgcacggggaagatcgccaacacggagggcatcaacagtgttgtaaaacaagatcccttcaagatctttc
cggaagagcccccaaacaccaccaacgtggaggagaccgtggagaggatccacaacaacgacagtggtctgacggaggtc
aacctcaacaacatcaaggacattcccatccccacgctgaaggaggtgtttgaggccatgaagggaaactcttacgttga
gatcctgagcatcgcagccacacggagcaacgaccccgtcgccttcgcatgtgcggagatgctgcaggagaacaccagtc
tccagagtcttaacattgagtctaacttcatcaccgcagagggcatgaaggctgtagtcaaggccatggccagcaacgcc
acgctggtggagctcaagatcgacaaccagaggcacaccctgggagactcggtggagatggagatcgccgccatgctgga
gaacaactccagcatcctgaagttcggctaccacttcacccagcaggggccccgggcccgggccgccatggccgtcacca
ggaacaacgatatgcttcgccaacagaggctgagatga
>gnl|bcl2dbcds|D2ITA0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=834 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgaccgtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtga
>gnl|bcl2dbcds|D2ITA0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=885 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgaccgtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtcagagggccaagtctccagggagaagaacagaaatttaccccaacaga
cgtaa
>gnl|bcl2dbcds|D2ITA0_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=1026 residues).
atgtcggaccccagggacatagacgaggatgccatcctcaaaggcctcagctctgcagagctggaacagctggagtgtga
gctccaggacctggaccccgagaatgccatgctcccagcgggctaccggcagcgggaccagaccaagaagacccccacgg
gggactatgaccgcgacgccctgcaggactacctggagaagagcgccctggagcacgaggacagggaagacctgatcccc
ttcaccggggagaagaaaggtaggaaggcgtttgttcccacggcgaccgggcagatccccctaagcgagcagatcaccct
ggagccggagctggaagaggccctgaagaacgccactgacgctgagatgtgcgacatcgcagctatccttggaatgtata
ccctgatgagcaacaagcagtactatgatgctctgggttgcacggggaagatcgccaacacggagggcatcaacagtgtt
gtaaaacaagatcccttcaagatctttccggaagagcccccaaacaccaccaacgtggaggagaccgtggagaggatcca
caacaacgacagtggtctgacggaggtcaacctcaacaacatcaaggacattcccatccccacgctgaaggaggtgtttg
aggccatgaagggaaactcttacgttgagatcctgagcatcgcagccacacggagcaacgaccccgtcgccttcgcatgt
gcggagatgctgcaggagaacaccagtctccagagtcttaacattgagtctaacttcatcaccgcagagggcatgaaggc
tgtagtcaaggccatggccagcaacgccacgctggtggagctcaagatcgacaaccagaggcacaccctgggagactcgg
tggagatggagatcgccgccatgctggagaacaactccagcatcctgaagttcggctaccacttcacccagcaggggccc
cgggcccgggccgccatggccgtcaccaggaacaacgatatgcttcgccaacagaggctgagatga
© 1998-2022Legal notice