Dataset for CDS BCL2L2 of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1LKF5_BCL2L2-01      atggcgaccccagcttcagccccagacacacgggctctagtggcagactt
G1LKF5_BCL2L2-02      atggcgaccccagcttcagccccagacacacgggctctagtggcagactt
                      **************************************************

G1LKF5_BCL2L2-01      tgtaggctataagctgaggcagaaaggttatgtgtgtggagctggccctg
G1LKF5_BCL2L2-02      tgtaggctataagctgaggcagaaaggttatgtgtgtggagctggccctg
                      **************************************************

G1LKF5_BCL2L2-01      gggagggcccagcagctgacccactgcaccaagccatgcgggcagctgga
G1LKF5_BCL2L2-02      gggagggcccagcagctgacccactgcaccaagccatgcgggcagctgga
                      **************************************************

G1LKF5_BCL2L2-01      gatgagtttgagacacgcttccggcgcaccttctctgatttggcagccca
G1LKF5_BCL2L2-02      gatgagtttgagacacgcttccggcgcaccttctctgatttggcagccca
                      **************************************************

G1LKF5_BCL2L2-01      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctg
G1LKF5_BCL2L2-02      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctg
                      **************************************************

G1LKF5_BCL2L2-01      atgaactcttccaagggggccccaactggggccgcctggtggccttcttt
G1LKF5_BCL2L2-02      atgaactcttccaagggggccccaactggggccgcctggtggccttcttt
                      **************************************************

G1LKF5_BCL2L2-01      gtctttggagccgcactgtgtgctgagagtgtcaacaaagagatggaacc
G1LKF5_BCL2L2-02      gtctttggagccgcactgtgtgctgagagtgtcaacaaagagatggaacc
                      **************************************************

G1LKF5_BCL2L2-01      acttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
G1LKF5_BCL2L2-02      acttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
                      **************************************************

G1LKF5_BCL2L2-01      tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaa
G1LKF5_BCL2L2-02      tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaa
                      **************************************************

G1LKF5_BCL2L2-01      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
G1LKF5_BCL2L2-02      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
                      **************************************************

G1LKF5_BCL2L2-01      gaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctg
G1LKF5_BCL2L2-02      gaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctg
                      **************************************************

G1LKF5_BCL2L2-01      gcccagtgatcatgtctattgaagagaagatggaggctgatgcccgttcc
G1LKF5_BCL2L2-02      gcccagtgatcatgtctattgaagagaagatggaggctgatgcccgttcc
                      **************************************************

G1LKF5_BCL2L2-01      atctatgttggcaacgtggactatggtgcaacagcagaagagctggaagc
G1LKF5_BCL2L2-02      atctatgttggcaacgtggactatggtgcaacagcagaagagctggaagc
                      **************************************************

G1LKF5_BCL2L2-01      acactttcatggctgtggttcagtcaatcgtgttaccatactctgtgaca
G1LKF5_BCL2L2-02      acactttcatggctgtggttcagtcaatcgtgttaccatactctgtgaca
                      **************************************************

G1LKF5_BCL2L2-01      aatttagtggccatcctaaagggtttgcatatatagagttctcagataaa
G1LKF5_BCL2L2-02      aatttagtggccatcctaaagggtttgcatatatagagttctcagataaa
                      **************************************************

G1LKF5_BCL2L2-01      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
G1LKF5_BCL2L2-02      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
                      **************************************************

G1LKF5_BCL2L2-01      acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacca
G1LKF5_BCL2L2-02      acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacca
                      **************************************************

G1LKF5_BCL2L2-01      cagaccggggtttcccacgagcccgataccgtgcccggaccaccaactac
G1LKF5_BCL2L2-02      cagaccggggtttcccacgagcccgataccgtgcccggaccaccaactac
                      **************************************************

G1LKF5_BCL2L2-01      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
G1LKF5_BCL2L2-02      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
                      **************************************************

G1LKF5_BCL2L2-01      tcgcgtctacaggggccgggctagagcgacatcatggt------ttctgt
G1LKF5_BCL2L2-02      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
                      **************************************       *   *

G1LKF5_BCL2L2-01      ag
G1LKF5_BCL2L2-02      aa
                      * 

© 1998-2022Legal notice