Dataset for CDS BCL-2 of organism Balaenoptera musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B8V3A7_BCL2-02      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaa
A0A8B8V3A7_BCL2-01      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaa
A0A8B8V3A7_BCL2-03      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaa
                        **************************************************

A0A8B8V3A7_BCL2-02      gtacatccactataagctgtcgcagaggggctacgagtgggatgccggag
A0A8B8V3A7_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtgggatgccggag
A0A8B8V3A7_BCL2-03      gtacatccactataagctgtcgcagaggggctacgagtgggatgccggag
                        **************************************************

A0A8B8V3A7_BCL2-02      acgcaggcaccgcgtccccgggggccgcccccgcgccaggcatcttctcc
A0A8B8V3A7_BCL2-01      acgcaggcaccgcgtccccgggggccgcccccgcgccaggcatcttctcc
A0A8B8V3A7_BCL2-03      acgcaggcaccgcgtccccgggggccgcccccgcgccaggcatcttctcc
                        **************************************************

A0A8B8V3A7_BCL2-02      tcccagcctgggcgcaccccagcgccatccaggacctccccgccgccgcc
A0A8B8V3A7_BCL2-01      tcccagcctgggcgcaccccagcgccatccaggacctccccgccgccgcc
A0A8B8V3A7_BCL2-03      tcccagcctgggcgcaccccagcgccatccaggacctccccgccgccgcc
                        **************************************************

A0A8B8V3A7_BCL2-02      ccagaccgcccccgccgcccccgccggggggcctgcgctcagccccgtgc
A0A8B8V3A7_BCL2-01      ccagaccgcccccgccgcccccgccggggggcctgcgctcagccccgtgc
A0A8B8V3A7_BCL2-03      ccagaccgcccccgccgcccccgccggggggcctgcgctcagccccgtgc
                        **************************************************

A0A8B8V3A7_BCL2-02      cacctgtggtccacctgaccctgcgccaggccggtgatgatttctctcgt
A0A8B8V3A7_BCL2-01      cacctgtggtccacctgaccctgcgccaggccggtgatgatttctctcgt
A0A8B8V3A7_BCL2-03      cacctgtggtccacctgaccctgcgccaggccggtgatgatttctctcgt
                        **************************************************

A0A8B8V3A7_BCL2-02      cgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcc
A0A8B8V3A7_BCL2-01      cgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcc
A0A8B8V3A7_BCL2-03      cgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcc
                        **************************************************

A0A8B8V3A7_BCL2-02      cttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
A0A8B8V3A7_BCL2-01      cttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
A0A8B8V3A7_BCL2-03      cttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
                        **************************************************

A0A8B8V3A7_BCL2-02      atggggtgaactgggggaggattgtggccttctttgagttcggtggggtc
A0A8B8V3A7_BCL2-01      atggggtgaactgggggaggattgtggccttctttgagttcggtggggtc
A0A8B8V3A7_BCL2-03      atggggtgaactgggggaggattgtggccttctttgagttcggtggggtc
                        **************************************************

A0A8B8V3A7_BCL2-02      atgtgtgtggagagcgtcaaccgggagatgtcccccctggtggacaacat
A0A8B8V3A7_BCL2-01      atgtgtgtggagagcgtcaaccgggagatgtcccccctggtggacaacat
A0A8B8V3A7_BCL2-03      atgtgtgtggagagcgtcaaccgggagatgtcccccctggtggacaacat
                        **************************************************

A0A8B8V3A7_BCL2-02      cgccctgtggatgactgagtacctgaaccgacacctgcacacctggatcc
A0A8B8V3A7_BCL2-01      cgccctgtggatgactgagtacctgaaccgacacctgcacacctggatcc
A0A8B8V3A7_BCL2-03      cgccctgtggatgactgagtacctgaaccgacacctgcacacctggatcc
                        **************************************************

A0A8B8V3A7_BCL2-02      aggataacggaggctggcacattccactcatcattgttattaactatttc
A0A8B8V3A7_BCL2-01      aggataacggaggctgg----------------------------gatgc
A0A8B8V3A7_BCL2-03      aggataacggaggctgg----------------------------a----
                        *****************                                 

A0A8B8V3A7_BCL2-02      ttctgcgcttcacatttgtctgaacttggaacatatgctta------cga
A0A8B8V3A7_BCL2-01      ctttgtggagctgtatggtcccagcatgcggcctctgtttgatttctcct
A0A8B8V3A7_BCL2-03      -------------------caaaagataaa-----------------ccc
                                           *  *   *                    *  

A0A8B8V3A7_BCL2-02      agctgttggaaacttcccaagcctatttgattctgctgatatt-------
A0A8B8V3A7_BCL2-01      ggctgtctctgaaggcactgctcagtctggccctggtgggagcttgcgtc
A0A8B8V3A7_BCL2-03      agctgtccttca-----------------------gtgagaat-------
                         *****     *                        **  *         

A0A8B8V3A7_BCL2-02      -tccatagtg-----------------tga
A0A8B8V3A7_BCL2-01      accctgggtgcctatctgggccataagtga
A0A8B8V3A7_BCL2-03      ------gatgac-----------ggaatga
                                **                 ***

© 1998-2022Legal notice