Dataset for CDS BAK1 of organism Catharus ustulatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3USA9_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Catharus ustulatus GN=BAK1 (length=630 residues).
cggggtcacagtgagggatggcctcggggtgaccatgagggctggcctcagggtgacaatgaggagggccgggtggcgga
ggaggccgaggaggtgttccgcagctacgccttctaccgctaccagcaggagcgcgccgagcgaggggcagagctgctgc
ccgaccccgagatcgagcaaatccagcaggacctggacagcaccagcagcgaggtggggcaccgcttggccatcatcggc
gatgacatctgccggcgctacgaggccgagttccgcaccatgctggagagcctgcagcccacgcgcgacaacgccttcga
gaacttcaccaaaatcgcctccagcctgttcgagagcggcatcaactggggccgtgtgatcgccctgctggcctttggtt
accgcctggccatgcacgtgtggcagtgcgggctgggcggcttcctgcgccgcatcgcgcgcttcctgggagaattcatg
ctgcaccaccgcatcgcccgctggatcgcgcagcagggaggatgggcggccgcgattcgccgctacaatgagatttacat
caagttcgtgctggtggcagccgtggtgctgctgggacacctggtggtgcggcgcttcttcccctcctga
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice