Dataset for CDS BAX-like of Organism Cyprinus carpio

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C1P637_BAX-01      ---------------atgg-----cagatgccaacgatggcgagagggta
A0A8C1P637_BAX-02      ---------------atgg-----cagatgccaacgatggcgagagggta
A0A8C1J6C3_BOK-01      ---------atggagatgttgcgccgctcctcagtgttcgcggctga--a
A0A8C1J6C3_BOK-02      atgaagggcatggagatgttgcgccgctcctcagtgttcgcggctga--a
A0A8C1J6C3_BOK-03      ---------------atgttgcgccgctcctcagtgttcgcggctga--a
X4ZER0_BAX-01          ---------------atgg------------cagcgccgtcgggcgg--a
A0A8C1PYL4_BAX-03      ---------------atgg------------cagcgccgtcgggtgg--a
A0A8C1PYL4_BAX-01      ---------------atgg-------------gttgctgtcgatt-----
A0A8C1PYL4_BAX-02      ---------------atg--------------------------------
                                      ***                                

A0A8C1P637_BAX-01      gacgaaaacgagctgaggggggctgccggtggtgaagatgtcatggatga
A0A8C1P637_BAX-02      gacgaaaacgagctgaggggggctgccggtggtgaagatgtcatggatga
A0A8C1J6C3_BOK-01      gtcatggaggtgtttgatcgctctcccacggataaggagctcgtgtctca
A0A8C1J6C3_BOK-02      gtcatggaggtgtttgatcgctctcccacggataaggagctcgtgtctca
A0A8C1J6C3_BOK-03      gtcatggaggtgtttgatcgctctcccacggataaggagctcgtgtctca
X4ZER0_BAX-01          ggcgatacg------gg---------cactggcaatgacc---------a
A0A8C1PYL4_BAX-03      ggcgatacggtagaagg---------cattggcaatgagc---------a
A0A8C1PYL4_BAX-01      -----taaagtagaagg---------cattggcaatgagc---------a
A0A8C1PYL4_BAX-02      ---------gcaggggt---------gtctgatcctg-------------
                                                     *     *             

A0A8C1P637_BAX-01      ggtgat--catcgaacagggtgcagttctactaagagggtatgtt-----
A0A8C1P637_BAX-02      ggtgat--catcgaacagggtgcagttctactaagagggtatgtt-----
A0A8C1J6C3_BOK-01      gtctaaagtcttgtgcaggg-attacattcactccagactccatcgggct
A0A8C1J6C3_BOK-02      gtctaaagtcttgtgcaggg-attacattcactccagactccatcgggct
A0A8C1J6C3_BOK-03      gtctaaagtcttgtgcaggg-attacattcactccagactccatcg----
X4ZER0_BAX-01          gataattgccttg----gga-tctgtacttctcaataacttcgtc-----
A0A8C1PYL4_BAX-03      gattatttccttg----gga-gctgcacttctcaataacttcatc-----
A0A8C1PYL4_BAX-01      gattatttccttg----gga-gctgcacttctcaataacttcatc-----
A0A8C1PYL4_BAX-02      --------cttct----gga-gggtcact---------cttcatc-----
                                 *      **         *          *   *      

A0A8C1P637_BAX-01      ------------attgaacgagtta------ctgtagagcatccagct--
A0A8C1P637_BAX-02      ------------attgaacgagtta------ctgtagagcatccagct--
A0A8C1J6C3_BOK-01      ggaatcggatggtctaaaccagagcatggatccggaggaacactggctga
A0A8C1J6C3_BOK-02      ggaatcggatggtctaaaccagagcatggatccggaggaacactggctga
A0A8C1J6C3_BOK-03      ------------------------------------ggaacactggctga
X4ZER0_BAX-01          ------------tatgaacgagttcgtcgttatggggacagcgaagctga
A0A8C1PYL4_BAX-03      ------------tatgaacgagttcgtcgccatggagacagtgaagctga
A0A8C1PYL4_BAX-01      ------------tatgaacgagttcgtcgccatggagacagtgaagctga
A0A8C1PYL4_BAX-02      ------------tatgaacgagttcgtcgccatggagacagtgaagctga
                                                           *        ***  

A0A8C1P637_BAX-01      attcgtgtgagccatgaggatttaggaggacgacctcaggaagcagatga
A0A8C1P637_BAX-02      attcgtgtgagccatgaggatttaggaggacgacctcaggaagcagatga
A0A8C1J6C3_BOK-01      ggtgtcttcagttcttctgtggttgggtgatgagct---ggagtacctgc
A0A8C1J6C3_BOK-02      ggtgtcttcagttcttctgtggttgggtgatgagct---ggagtacctgc
A0A8C1J6C3_BOK-03      ggtgtcttcagttcttctgt-----ggtgatgagct---ggagtacctgc
X4ZER0_BAX-01          agtaacccgaagtcagctgggt---ggtgttgagct---g-------tgc
A0A8C1PYL4_BAX-03      attaacccgaagtcagctgggt---ggtgttgagct---g-------tgc
A0A8C1PYL4_BAX-01      attaacccgaagtcagctgggt---ggtgttgagct---g-------tgc
A0A8C1PYL4_BAX-02      attaacccgaagtcagctgggt---ggtgttgagct---g-------tgc
                         *      *        *      *  *  ** **   *       ** 

A0A8C1P637_BAX-01      tcctcaaatcaaagaggttgtagatcaacttttgaag---atagccgacg
A0A8C1P637_BAX-02      tcctcaaatcaaagaggttgtagatcaacttttgaag---atagccgacg
A0A8C1J6C3_BOK-01      gaccc--------aatg-tgtaccgcaacgt----agca------agac-
A0A8C1J6C3_BOK-02      gaccc--------aatg-tgtaccgcaacgt----agca------agac-
A0A8C1J6C3_BOK-03      gaccc--------aatg-tgtaccgcaacgt----agca------agac-
X4ZER0_BAX-01          gaccccaaccataaacg-tctagggcagtgcttacagcaaattggagatg
A0A8C1PYL4_BAX-03      gaccccagccataaacg-tcttgcgcagtgtttgcagcagattggagatg
A0A8C1PYL4_BAX-01      gaccccagccataaacg-tcttgcgcagtgtttgcagcagattggagatg
A0A8C1PYL4_BAX-02      gaccccagccataaacg-tcttgcgcagtgtttgcagcagattggagatg
                         * *         * * * *    **        **         **  

A0A8C1P637_BAX-01      accttaacaagaatgctg-aactgcaacatctcat------cagcactgt
A0A8C1P637_BAX-02      accttaacaagaatgctg-aactgcaacatctcat------cagcactgt
A0A8C1J6C3_BOK-01      agctcaacatcactattgcatctg-agagtatagt-----------ctct
A0A8C1J6C3_BOK-02      agctcaacatcactattgcatctg-agagtatagt-----------ctct
A0A8C1J6C3_BOK-03      agctcaacatcactattgcatctg-agagtatagt-----------ctct
X4ZER0_BAX-01          agctggatggaaatg-tgcagctgcaaagtatggtaaatgaccctgctct
A0A8C1PYL4_BAX-03      agctggatggaaatg-tgcagctgcaaagtatgttaaatgactccactct
A0A8C1PYL4_BAX-01      agctggatggaaatg-tgcagctgcaaagtatgttaaatgactccactct
A0A8C1PYL4_BAX-02      agctggatggaaatg-tgcagctgcaaagtatgttaaatgactccactct
                       * **  *    * *  ** * *** *   * *  *           ** *

A0A8C1P637_BAX-01      gcaatcaaactgcgctcaggacgtcttcatgactgtggccaggagcatct
A0A8C1P637_BAX-02      gcaatcaaactgcgctcaggacgtcttcatgactgtggccaggagcatct
A0A8C1J6C3_BOK-01      -------------------gatgcctttttggccgttgctgccgaaatct
A0A8C1J6C3_BOK-02      -------------------gatgcctttttggccgttgctgccgaaatct
A0A8C1J6C3_BOK-03      -------------------gatgcctttttggccgttgctgccgaaatct
X4ZER0_BAX-01          tcagccaa------ctcaagaagtcttcatgaaagtggcccgagagatct
A0A8C1PYL4_BAX-03      tcaaccaa------ctcaagaagtcttcatgaaagtggcccgcgagatct
A0A8C1PYL4_BAX-01      tcaaccaa------ctcaagaagtcttcatgaaagtggcccgcgagatct
A0A8C1PYL4_BAX-02      tcaaccaa------ctcaagaagtcttcatgaaagtggcccgcgagatct
                                          ** * ***  **   ** **       ****

A0A8C1P637_BAX-01      ttgaggatgg-----------------------------------ca---
A0A8C1P637_BAX-02      ttgaggatgg-----------------------------------ca---
A0A8C1J6C3_BOK-01      tctctacaggcaattatttcagaaagtacaccttggaaaaatacccaggt
A0A8C1J6C3_BOK-02      tctcta---------------------------------------caggt
A0A8C1J6C3_BOK-03      tctcta---------------------------------------caggt
X4ZER0_BAX-01          tctctgatgg-----------------------------------gaagt
A0A8C1PYL4_BAX-03      tctctgatgg-----------------------------------gaagt
A0A8C1PYL4_BAX-01      tctctgatgg-----------------------------------gaagt
A0A8C1PYL4_BAX-02      tctctgatgg-----------------------------------gaagt
                       *                                             *   

A0A8C1P637_BAX-01      ttaac-tggggacgtattgtggcactgtttcacctcgcgtatagg----c
A0A8C1P637_BAX-02      ttaac-tggggacgtattgtggcactgtttcacctcgcgtatagg----c
A0A8C1J6C3_BOK-01      gtaacatgggggaagattgtatc---tctgtatgctgtg-gccggagctc
A0A8C1J6C3_BOK-02      gtaacatgggggaagattgtatc---tctgtatgctgtg-gccggagctc
A0A8C1J6C3_BOK-03      gtaacatgggggaagattgtatc---tctgtatgctgtg-gccggagctc
X4ZER0_BAX-01          tcaac-tggggcagagtggtggcgcttttctactttgcgtgtcgg----c
A0A8C1PYL4_BAX-03      tcaac-tggggcagagtggtggcgcttttctactttgcgtgtcgg----c
A0A8C1PYL4_BAX-01      tcaac-tggggcagagtggtggcgcttttctactttgcgtgtcgg----c
A0A8C1PYL4_BAX-02      tcaac-tggggcagagtggtggcgcttttctactttgcgtgtcgg----c
                         *** *****     * **  *     *  *    * *    **    *

A0A8C1P637_BAX-01      tcatttaccaggctctgactcagaaccactttgacattatcaagaggatc
A0A8C1P637_BAX-02      tcatttaccaggctctgactcagaaccactttgacattatcaagaggatc
A0A8C1J6C3_BOK-01      tagccgtggactgtgttcggcatgggcatccagcgatggtgcacaccatt
A0A8C1J6C3_BOK-02      tagccgtggactgtgttcggcatgggcatccagcgatggtgcacaccatt
A0A8C1J6C3_BOK-03      tagccgtggactgtgttcggcatgggcatccagcgatggtgcacaccatt
X4ZER0_BAX-01          ttgtcgtcaaggctattacaaacaagattcgtgacatcatcagaaccatc
A0A8C1PYL4_BAX-03      ttgtcatcaaggctattataaccaagattcctgacatcataagaaccatc
A0A8C1PYL4_BAX-01      ttgtcatcaaggctattataaccaagattcctgacatcataagaaccatc
A0A8C1PYL4_BAX-02      ttgtcatcaaggctattataaccaagattcctgacatcataagaaccatc
                       *        *   * *                *  **  *    *  ** 

A0A8C1P637_BAX-01      attagctgggttttacagtttatcaaggaaaacatttctgtctggatc--
A0A8C1P637_BAX-02      attagctgggttttacagtttatcaaggaaaacatttctgtctggatc--
A0A8C1J6C3_BOK-01      gtcgactgcatgggcgagtttgttcgcaaaagccttgtgtcatggttaaa
A0A8C1J6C3_BOK-02      gtcgactgcatgggcgagtttgttcgcaaaagccttgtgtcatggttaaa
A0A8C1J6C3_BOK-03      gtcgactgcatgggcgagtttgttcgcaaaagccttgtgtcatggttaaa
X4ZER0_BAX-01          ataagctggactatgtcctacattcaggaacacgttattaactggatc--
A0A8C1PYL4_BAX-03      ataaactggactatgtcctacattcaggaacacgttattacctggatc--
A0A8C1PYL4_BAX-01      ataaactggactatgtcctacattcaggaacacgttattacctggatc--
A0A8C1PYL4_BAX-02      ataaactggactatgtcctacattcaggaacacgttattacctggatc--
                        *   ***          *   *     **  * **      *** *   

A0A8C1P637_BAX-01      ------agacagcaaggaggatgggagggcattttccgcaacgtgtcaag
A0A8C1P637_BAX-02      ------agacagcaaggaggatgggtaagttgctgtttgtgtgtgtgcgt
A0A8C1J6C3_BOK-01      gaggagaggaggctgggcggacatcacaaagtgtgtagtcaatacagatc
A0A8C1J6C3_BOK-02      gaggagaggaggctgggcggacatcacaaagtgtgtagtcaatacagatc
A0A8C1J6C3_BOK-03      gaggagaggaggctgggcggacatcacaaagtgtgtagtcaatacagatc
X4ZER0_BAX-01          ------agggaacagggtggatggaacgctgactgtttctatagc--aac
A0A8C1PYL4_BAX-03      ------agggaacagggtggatggaacgctgactgtttctatagc--aac
A0A8C1PYL4_BAX-01      ------agggaacagggtggatgggagggaatccgctcctatttcggaac
A0A8C1PYL4_BAX-02      ------agggaacagggtggatgggagggaatccgctcctatttcggaac
                             **    *  ** ***                             

A0A8C1P637_BAX-01      atggcgta--ctgtgt-----------------------------ctttc
A0A8C1P637_BAX-02      ctggccac--ccatgtggagccacacaggtcgagccagacatgggccacc
A0A8C1J6C3_BOK-01      c---------cagttttcgttctcattgg------ctggtggcagctgcc
A0A8C1J6C3_BOK-02      c---------cagttttcgttctcattgg------ctggtggcagctgcc
A0A8C1J6C3_BOK-03      c---------cagttttcgttctcattgg------ctggtggcagctgcc
X4ZER0_BAX-01          tgggacgcttctaactgcagctgcagtga------c--gtgctgacttta
A0A8C1PYL4_BAX-03      cgggacgcttctaactgcagctgcagtga------c--gtgctgacttta
A0A8C1PYL4_BAX-01      cccaacatggcagact--------attgg------c--gt------tttc
A0A8C1PYL4_BAX-02      cccaacatggcagact--------attgg------c--gt------tttc
                                 *    *                                  

A0A8C1P637_BAX-01      at-cgctgcgatg-gcattcattgcagctgt-------------------
A0A8C1P637_BAX-02      acacacagagagacgcacccacttgggccaggaagtacataagcacaaac
A0A8C1J6C3_BOK-01      tgtgcctgcg-------gtcactatctcaaggctgtggtcttctacc---
A0A8C1J6C3_BOK-02      tgtgcctgcg-------gtcactatctcaaggctgtggtcttctacc---
A0A8C1J6C3_BOK-03      tgtgcctgcg-------gtcactatctcaaggctgtggtcttctacc---
X4ZER0_BAX-01          ccgattagcga---ttggctccttcattcagaaggcgg------------
A0A8C1PYL4_BAX-03      ccgattagcga---ttggctccttcattcagaaggcgg------------
A0A8C1PYL4_BAX-01      ctggccgggg-----tgctcaccacagtt-----gtgg------------
A0A8C1PYL4_BAX-02      ctggccgggg-----tgctcaccacagtt-----gtgg------------
                              * *                                        

A0A8C1P637_BAX-01      ---------tgtttactggaga-----------agaacgcgttaa-----
A0A8C1P637_BAX-02      ccagacacatgccttctaggaatatccagacacaaaacccactgacttag
A0A8C1J6C3_BOK-01      ---------tgctgagagaaaa-------------------ataa-----
A0A8C1J6C3_BOK-02      ---------tgctgagagaaaa-------------------ataa-----
A0A8C1J6C3_BOK-03      ---------tgctgagagaaaa-------------------ataa-----
X4ZER0_BAX-01          ---------ggcttcctgcgat--------------------tga-----
A0A8C1PYL4_BAX-03      ---------ggcttcctgcgat--------------------tga-----
A0A8C1PYL4_BAX-01      ---------tgatgcgcaaaat-------------------gtga-----
A0A8C1PYL4_BAX-02      ---------tgatgcgcaaaat-------------------gtga-----
                                 *                               * *     

© 1998-2023Legal notice