Dataset for CDS BCL2L1 of organism Marmota marmota marmota

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5YLY6_BCL2L1-      atagagagttgtggtaggacaggaaggaacctggaactagtgatggactt
A0A8C6ACA1_BCL2L1-      at---------------gtctcagagcaaccgggagctggtggttgactt
A0A8C6ACA1_BCL2L1-      at---------------gtctcagagcaaccgggagctggtggttgactt
                        **               * *    ** **** *** ** *** * *****

A0A8C5YLY6_BCL2L1-      tctgtcctacaagctttcccagaaaggataccgctggagccagtttagcc
A0A8C6ACA1_BCL2L1-      tctctcctacaagctttcccagaaaggatacagctggagtcagtttagcg
A0A8C6ACA1_BCL2L1-      tctctcctacaagctttcccagaaaggatacagctggagtcagtttagcg
                        *** *************************** ******* ********* 

A0A8C5YLY6_BCL2L1-      gtgaggaagagaaccgcgttcaagccccagaaagggctgaatcagaagag
A0A8C6ACA1_BCL2L1-      atgtggaagagaacaggactgaagccccagaagggactgaatcagaggtg
A0A8C6ACA1_BCL2L1-      atgtggaagagaacaggactgaagccccagaagggactgaatcagaggtg
                         ** ********** *   * *********** ** ********** * *

A0A8C5YLY6_BCL2L1-      gggcccagcaatgccaccagcggcaacccatcccggcatcagggggacag
A0A8C6ACA1_BCL2L1-      gagacccccagtgccatcaatggcaacccatcctggcatctggcggacag
A0A8C6ACA1_BCL2L1-      gagacccccagtgccatcaatggcaacccatcctggcatctggcggacag
                        * * **  ** ***** **  ************ ****** ** ******

A0A8C5YLY6_BCL2L1-      tcccatggtgagtggagccgctggccataacaggagtttggatgcccccg
A0A8C6ACA1_BCL2L1-      ccctgcggtaaatggagccactggtcacagcagcagtttggatgcccggg
A0A8C6ACA1_BCL2L1-      ccctgcggtaaatggagccactggtcacagcagcagtttggatgcccggg
                         **   *** * ******* **** ** * *** *************  *

A0A8C5YLY6_BCL2L1-      acgtggtccccatggtagcagtgaagcaagcgatgagggaggcaggcgac
A0A8C6ACA1_BCL2L1-      aggtgatccccatggcagcagtgaagcaagcattgagggaggcaggcgac
A0A8C6ACA1_BCL2L1-      aggtgatccccatggcagcagtgaagcaagcattgagggaggcaggcgac
                        * *** ********* ***************  *****************

A0A8C5YLY6_BCL2L1-      aactttgaagggcggtaccggcaggcattccatgacctgacagcagagct
A0A8C6ACA1_BCL2L1-      gagtttgaactgcggtaccggcgggcattcagtgacctgacgtcccagct
A0A8C6ACA1_BCL2L1-      gagtttgaactgcggtaccggcgggcattcagtgacctgacgtcccagct
                         * ******  *********** *******  *********  *  ****

A0A8C5YLY6_BCL2L1-      ccgcctcaccccggagacagcacatcacacttttgaacaggtagtggacg
A0A8C6ACA1_BCL2L1-      ccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacg
A0A8C6ACA1_BCL2L1-      ccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacg
                        ** * ********* ******* **** *  *************** ***

A0A8C5YLY6_BCL2L1-      aactcttccgggatgaggtaagctggggtcgcattgtggcctttttcttc
A0A8C6ACA1_BCL2L1-      aactcttccgggatggggtaaactggggtcgcattgtggcctttttctcc
A0A8C6ACA1_BCL2L1-      aactcttccgggatggggtaaactggggtcgcattgtggcctttttctcc
                        *************** ***** ************************** *

A0A8C5YLY6_BCL2L1-      tttggaggagcactgtgcttggaaagcatagacaaggagatgaaggtgtt
A0A8C6ACA1_BCL2L1-      ttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtatt
A0A8C6ACA1_BCL2L1-      ttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtatt
                        ** ** ** ********* ******** ************** **** **

A0A8C5YLY6_BCL2L1-      ggtgtgtcagatcgcaagttggatgaccacttacctgaatgatcacctag
A0A8C6ACA1_BCL2L1-      ggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctag
A0A8C6ACA1_BCL2L1-      ggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctag
                        **** *** **************** **************** *******

A0A8C5YLY6_BCL2L1-      atacttggatccaggaccacggcggctgggacactttt------------
A0A8C6ACA1_BCL2L1-      agccttggatccaggagaacggcggctgggacacttttgtggaactctac
A0A8C6ACA1_BCL2L1-      agccttggatccaggagaacggcggctgggacacttttgtggaactctac
                        *  *************  ********************            

A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8C6ACA1_BCL2L1-      gggaataacgcggcagcagagagccggaagggccaggagcgcttcaaccg
A0A8C6ACA1_BCL2L1-      gggaataacgcggcagcagagagccggaagggccaggagcgcttcaaccg
                                                                          

A0A8C5YLY6_BCL2L1-      ----------------------------------------ctggcttgtc
A0A8C6ACA1_BCL2L1-      ttggttcctgacgggcatgactgtggccggcgtggttctgctgggctcgc
A0A8C6ACA1_BCL2L1-      ttggttcctgacgggcatgactgtggccggcgtggttctgctgggctcgc
                                                                ****  *  *

A0A8C5YLY6_BCL2L1-      ttatc---------tga
A0A8C6ACA1_BCL2L1-      ttttcagtcggaaatga
A0A8C6ACA1_BCL2L1-      ttttcagtcggaaatga
                        ** **         ***

© 1998-2022Legal notice