Dataset for CDS BCL2L1 of organism Marmota marmota marmota

[Download (right click)] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A8C6ACA1_BCL2L1-01      ---------------atgtctcagagcaaccgggagctggtggttgactt
A0A8C5YLY6_BCL2L1-01      atagagagttgtggtaggacaggaaggaacctggaactagtgatggactt
A0A8C6ACA1_BCL2L1-02      ---------------atgtctcagagcaaccgggagctggtggttgactt
                                         * * *    ** **** *** ** *** * *****

A0A8C6ACA1_BCL2L1-01      tctctcctacaagctttcccagaaaggatacagctggagtcagtttagcg
A0A8C5YLY6_BCL2L1-01      tctgtcctacaagctttcccagaaaggataccgctggagccagtttagcc
A0A8C6ACA1_BCL2L1-02      tctctcctacaagctttcccagaaaggatacagctggagtcagtttagcg
                          *** *************************** ******* ********* 

A0A8C6ACA1_BCL2L1-01      atgtggaagagaacaggactgaagccccagaagggactgaatcagaggtg
A0A8C5YLY6_BCL2L1-01      gtgaggaagagaaccgcgttcaagccccagaaagggctgaatcagaagag
A0A8C6ACA1_BCL2L1-02      atgtggaagagaacaggactgaagccccagaagggactgaatcagaggtg
                           ** ********** *   * *********** ** ********** * *

A0A8C6ACA1_BCL2L1-01      gagacccccagtgccatcaatggcaacccatcctggcatctggcggacag
A0A8C5YLY6_BCL2L1-01      gggcccagcaatgccaccagcggcaacccatcccggcatcagggggacag
A0A8C6ACA1_BCL2L1-02      gagacccccagtgccatcaatggcaacccatcctggcatctggcggacag
                          * * **  ** ***** **  ************ ****** ** ******

A0A8C6ACA1_BCL2L1-01      ccctgcggtaaatggagccactggtcacagcagcagtttggatgcccggg
A0A8C5YLY6_BCL2L1-01      tcccatggtgagtggagccgctggccataacaggagtttggatgcccccg
A0A8C6ACA1_BCL2L1-02      ccctgcggtaaatggagccactggtcacagcagcagtttggatgcccggg
                           **   *** * ******* **** ** * *** *************  *

A0A8C6ACA1_BCL2L1-01      aggtgatccccatggcagcagtgaagcaagcattgagggaggcaggcgac
A0A8C5YLY6_BCL2L1-01      acgtggtccccatggtagcagtgaagcaagcgatgagggaggcaggcgac
A0A8C6ACA1_BCL2L1-02      aggtgatccccatggcagcagtgaagcaagcattgagggaggcaggcgac
                          * *** ********* ***************  *****************

A0A8C6ACA1_BCL2L1-01      gagtttgaactgcggtaccggcgggcattcagtgacctgacgtcccagct
A0A8C5YLY6_BCL2L1-01      aactttgaagggcggtaccggcaggcattccatgacctgacagcagagct
A0A8C6ACA1_BCL2L1-02      gagtttgaactgcggtaccggcgggcattcagtgacctgacgtcccagct
                           * ******  *********** *******  *********  *  ****

A0A8C6ACA1_BCL2L1-01      ccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacg
A0A8C5YLY6_BCL2L1-01      ccgcctcaccccggagacagcacatcacacttttgaacaggtagtggacg
A0A8C6ACA1_BCL2L1-02      ccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacg
                          ** * ********* ******* **** *  *************** ***

A0A8C6ACA1_BCL2L1-01      aactcttccgggatggggtaaactggggtcgcattgtggcctttttctcc
A0A8C5YLY6_BCL2L1-01      aactcttccgggatgaggtaagctggggtcgcattgtggcctttttcttc
A0A8C6ACA1_BCL2L1-02      aactcttccgggatggggtaaactggggtcgcattgtggcctttttctcc
                          *************** ***** ************************** *

A0A8C6ACA1_BCL2L1-01      ttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtatt
A0A8C5YLY6_BCL2L1-01      tttggaggagcactgtgcttggaaagcatagacaaggagatgaaggtgtt
A0A8C6ACA1_BCL2L1-02      ttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtatt
                          ** ** ** ********* ******** ************** **** **

A0A8C6ACA1_BCL2L1-01      ggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctag
A0A8C5YLY6_BCL2L1-01      ggtgtgtcagatcgcaagttggatgaccacttacctgaatgatcacctag
A0A8C6ACA1_BCL2L1-02      ggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctag
                          **** *** **************** **************** *******

A0A8C6ACA1_BCL2L1-01      agccttggatccaggagaacggcggctgggacacttttgtggaactctac
A0A8C5YLY6_BCL2L1-01      atacttggatccaggaccacggcggctgggacacttttctggct------
A0A8C6ACA1_BCL2L1-02      agccttggatccaggagaacggcggctgggacacttttgtggaactctac
                          *  *************  ******************** ***        

A0A8C6ACA1_BCL2L1-01      gggaataacgcggcagcagagagccggaagggccaggagcgcttcaaccg
A0A8C5YLY6_BCL2L1-01      --------------------------------------------------
A0A8C6ACA1_BCL2L1-02      gggaataacgcggcagcagagagccggaagggccaggagcgcttcaaccg
                                                                            

A0A8C6ACA1_BCL2L1-01      ttggttcctgacgggcatgactgtggccggcgtggttctgctgggctcgc
A0A8C5YLY6_BCL2L1-01      --------------------------------------------------
A0A8C6ACA1_BCL2L1-02      ttggttcctgacgggcatgactgtggccggcgtggttctgctgggctcgc
                                                                            

A0A8C6ACA1_BCL2L1-01      ttttcagtcggaaatga
A0A8C5YLY6_BCL2L1-01      -----tgtcttatctga
A0A8C6ACA1_BCL2L1-02      ttttcagtcggaaatga
                                ***  *  ***

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice