Dataset for CDS BCL-2-like of organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

37 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      ------------atgttcggcctcaagagaaacgcagtaatcggactaaa
A5PJR2_MCL1-01          ------------atgttcggcctcaagagaaacgcagtaatcggactaaa
A0A4W2D770_MCL1-02      ------------atgttcggcctcaagagaaacgcagtaatcggactaaa
F1MQX4_MCL1-01          ggaatgttgccaatattt--------------------------------
A0A4W2CQV1_MCL1-01      ------------atgtgt--------------------------------
A0A4W2G6Q5_MCL1-01      ------------atgtgt--------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      cctctattgtgggggagccggattaggacagggcagcggcgcctcctctc
A5PJR2_MCL1-01          cctctattgtgggggagccggattaggacagggcagcggcgcctcctctc
A0A4W2D770_MCL1-02      cctctattgtgggggagccggattaggacagggcagcggcgcctcctctc
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      -------------------atgggaacggttctcttttctgggcacccac
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      cgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagag
A5PJR2_MCL1-01          cgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagag
A0A4W2D770_MCL1-02      cgggggggcggctttt----------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      tccagggctggaagagttcaacaagtgcatggaacgtcagagaccttctg
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      gtagggggaggggaagccggcacggtgattggcggaagcgccggcccgag
A5PJR2_MCL1-01          gtagggggaggggaagccggcacggtgattggcggaagcgccggcccgag
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gaaatgctgaatttactccaaggtttcatgaggcccagccggcttctctt
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      ccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgc
A5PJR2_MCL1-01          ccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgc
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      cacagcctccagggtcagaagccctgcctggcccttgatgccctcctggc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      ccattggcgccgagggccccgacgtcaccgcgacccccaccagactgctg
A5PJR2_MCL1-01          ccattggcgccgagggccccgacgtcaccgcgacccccaccagactgctg
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      cctgttcttcctggcctccagcagccctcttctttcctgagttgtggctc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      ttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatcccc
A5PJR2_MCL1-01          ttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatcccc
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ttcccaagcctgcgtcccagccccgcccctctctctggacgcatctctgg
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      gatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagc
A5PJR2_MCL1-01          gatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagc
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gccccatcatcacccggcgccgggccctccctcccgccccccctttctcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      cagaccctctcgggaagcggcctgccgtccggcctttacctttgttggtc
A5PJR2_MCL1-01          cagaccctctcgggaagcggcctgccgtccggcctttacctttgttggtc
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      tccctccttccttccctcccttcctccctgtctccctccctcccagctcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      ------------------------------------------------at
Q3C2I0_BCL2A1-01        ------------------------------------------------at
A0A4W2DYC0_BCL2A1-      ------------------------------------------------at
A0A4W2DYC0_BCL2A1-      ------------------------------------------------at
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      ggagaagccagtaacaacagtccaggctcggacggctcgctgccctcgac
A5PJR2_MCL1-01          ggagaagccagtaacaacagtccaggctcggacggctcgctgccctcgac
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      ------------------------------------------------at
A0A4W2BWN1_BCL2-01      ------------------------------------------------at
F6R2C4_BCL2-01          ------------------------------------------------at
O02718_BCL2-01          ------------------------------------------------at
A0A4W2D6A3_BCL2L2-      ------------------------------------------------at
A0A4W2GUJ7_BCL2L2-      ------------------------------------------------at
A0A4W2GUJ7_BCL2L2-      ------------------------------------------------at
A0A4W2D6A3_BCL2L2-      ------------------------------------------------at
A0A4W2GUJ7_BCL2L2-      ------------------------------------------------at
A0A4W2GUJ7_BCL2L2-      ------------------------------------------------at
A0A4W2D6A3_BCL2L2-      ------------------------------------------------at
A0A4W2D6A3_BCL2L2-      ------------------------------------------------at
A0A4W2GUJ7_BCL2L2-      tgcaccaggaaacagccggatcccggcagcggcctgacccccgcccggat
A0A4W2GUJ7_BCL2L2-      ------------------------------------------------at
Q1RMX3_BCL2L2-01        ------------------------------------------------at
Q05KI8_BCL2L2-01        ------------------------------------------------at
                                                                          

A0A4W2DYC0_BCL2A1-      g----------------------------ac--tg--------acactga
Q3C2I0_BCL2A1-01        g----------------------------ac--tg--------acactga
A0A4W2DYC0_BCL2A1-      ggaaaaggaatttgaagatggcattgttaac--tg--------gggcagg
A0A4W2DYC0_BCL2A1-      ggcggcagcggtggccgtgagcggcgccaag--cggagcctgcgggccga
A0A4W2EB77_BCL2L10      ------------------------------------------atggtgga
E1B9B3_BCL2L10-01       --------------------atgactga---a-ggcggagccatggtgga
F1MV39_BCL2L10-01       --------------------gttgctgatgga-caggaaagcctggt---
A0A4W2C0F3_BCL2L10      --------------------tcagctgactca-cttcattccatggtgga
A0A4W2FG99_BCL2L10      --------------------tcagctgactca-cttcattccatggtgga
A0A4W2GX13_BCL2L1-      ------------------atgtctcagagtaaccgggagctggtggttga
Q05KJ0_BCL2L1-01        ------------------atgtctcagagtaaccgggagctggtggttga
Q05KJ0_BCL2L1-02        ------------------atgtctcagagtaaccgggagctggtggttga
A0A3Q1LRT3_BCL2L1-      ------------------atgtctcagagcaatcgggaactagtggttga
A0A4W2D608_BCL2L1-      ------------------atgtctcagagcaatcgggaactagtggttga
A0A4W2F845_BCL2L1-      ------------------atgtctcagagcaatcgggaactagtggttga
A0A4W2D770_MCL1-01      gccgcccccagcag----aggaggaggagga--cgagttatatcggcagt
A5PJR2_MCL1-01          gccgcccccagcag----aggaggaggagga--cgagttatatcggcagt
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          ----------tcag----aggaggaggagga--cgagttatattggcagt
A0A4W2CQV1_MCL1-01      -------------g----aggaggaggagga--cgagttatattggcagt
A0A4W2G6Q5_MCL1-01      -------------g----aggaggaggagga--cgagttatattggcagt
A0A4W2BWN1_BCL2-02      ggcgcacgcggggggaacaggctacgataac--cgagagatcgtgatgaa
A0A4W2BWN1_BCL2-01      ggcgcacgcggggggaacaggctacgataac--cgagagatcgtgatgaa
F6R2C4_BCL2-01          ggcgcacgcggggggaacaggctacgataac--cgagagatcgtgatgaa
O02718_BCL2-01          ggcgcacgcggggggaacaggctacgataac--cgagagatcgtgatgaa
A0A4W2D6A3_BCL2L2-      ggcggcggcggcgg----cggcggcagcagcagcgggggct----gcggg
A0A4W2GUJ7_BCL2L2-      ggcggcggcggcgg----cggcggcagcagcagcgggggct----gcggg
A0A4W2GUJ7_BCL2L2-      ggcgaccccagcct----cggccccagacaca-cgggctctagtggcaga
A0A4W2D6A3_BCL2L2-      ggcgaccccagcct----cggccccagacaca-cgggctctagtggcaga
A0A4W2GUJ7_BCL2L2-      ggcgaccccagcct----cggccccagacaca-cgggctctagtggcaga
A0A4W2GUJ7_BCL2L2-      ggcgaccccagcct----cggccccagacaca-cgggctctagtggcaga
A0A4W2D6A3_BCL2L2-      ggcgaccccagcct----cggccccagacaca-cgggctctagtggcaga
A0A4W2D6A3_BCL2L2-      ggcgaccccagcct----cggccccagacaca-cgggctctagtggcaga
A0A4W2GUJ7_BCL2L2-      ggcgaccccagcct----cggccccagacaca-cgggctctagtggcaga
A0A4W2GUJ7_BCL2L2-      ggcgaccccagcct----cggccccagacaca-cgggctctagtggcaga
Q1RMX3_BCL2L2-01        ggcgaccccagcct----cggccccagacaca-cgggctctagtggcaga
Q05KI8_BCL2L2-01        ggcgaccccagcct----cggccccagacaca-cgggctctagtggcaga
                                                                          

A0A4W2DYC0_BCL2A1-      gtt-tggct----------acgttcacgggc-------------tggctg
Q3C2I0_BCL2A1-01        gtt-tggct----------acgttcacgggc-------------tggctg
A0A4W2DYC0_BCL2A1-      attgtaacc----------atattcgc---ctttgaaggtattcttacca
A0A4W2DYC0_BCL2A1-      gctgaagca----------gcgtctgcgggcgctgagcg--------ctg
A0A4W2EB77_BCL2L10      cccgtttag-----------------------------------------
E1B9B3_BCL2L10-01       cccgtttag-----------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      cccgtttag-----------------------------------------
A0A4W2FG99_BCL2L10      cccgtttag-----------------------------------------
A0A4W2GX13_BCL2L1-      ctttctctc--------------ttacaagc-------------------
Q05KJ0_BCL2L1-01        ctttctctc--------------ttacaagc-------------------
Q05KJ0_BCL2L1-02        ctttctctc--------------ttacaagc-------------------
A0A3Q1LRT3_BCL2L1-      ctttctctc--------------ttacaagc-------------------
A0A4W2D608_BCL2L1-      ctttctctc--------------ttacaagc-------------------
A0A4W2F845_BCL2L1-      ctttctctc--------------ttacaagc-------------------
A0A4W2D770_MCL1-01      ccctggagataatctctcagtacctccggga-------------------
A5PJR2_MCL1-01          ccctggagataatctctcagtacctccggga-------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          ccctggagattatctctcggtacctccggga-------------------
A0A4W2CQV1_MCL1-01      ccctggagattatctctcggtacctccggga-------------------
A0A4W2G6Q5_MCL1-01      ccctggagattatctctcggtacctccggga-------------------
A0A4W2BWN1_BCL2-02      gtacatcca--------------ctataagc-------------------
A0A4W2BWN1_BCL2-01      gtacatcca--------------ctataagc-------------------
F6R2C4_BCL2-01          gtacatcca--------------ctataagc-------------------
O02718_BCL2-01          gtacatcca--------------ctataagc-------------------
A0A4W2D6A3_BCL2L2-      cggtcgggg--------------ctccgggc-------------------
A0A4W2GUJ7_BCL2L2-      cggtcgggg--------------ctccgggc-------------------
A0A4W2GUJ7_BCL2L2-      ctttgtggg--------------ctataagc-------------------
A0A4W2D6A3_BCL2L2-      ctttgtggg--------------ctataagc-------------------
A0A4W2GUJ7_BCL2L2-      ctttgtggg--------------ctataagc-------------------
A0A4W2GUJ7_BCL2L2-      ctttgtggg--------------ctataagc-------------------
A0A4W2D6A3_BCL2L2-      ctttgtggg--------------ctataagc-------------------
A0A4W2D6A3_BCL2L2-      ctttgtggg--------------ctataagc-------------------
A0A4W2GUJ7_BCL2L2-      ctttgtggg--------------ctataagc-------------------
A0A4W2GUJ7_BCL2L2-      ctttgtggg--------------ctataagc-------------------
Q1RMX3_BCL2L2-01        ctttgtggg--------------ctataagc-------------------
Q05KI8_BCL2L2-01        ctttgtggg--------------ctataagc-------------------
                                                                          

A0A4W2DYC0_BCL2A1-      agga----------------------------------------------
Q3C2I0_BCL2A1-01        agga----------------------------------------------
A0A4W2DYC0_BCL2A1-      agaaacttctgggcaagtgtattgcctcagacatggacatgtgcaaggac
A0A4W2DYC0_BCL2A1-      aggagcggctgcgccag---------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      atttctttctttgtggcggagttcatcaccgaaaatacaggagagtggat
A0A4W2DYC0_BCL2A1-      ---tcccacctcttggc-----------ccagaa----------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      -----------------------ctatctgaaatatgtgttg-cagatac
Q3C2I0_BCL2A1-01        -----------------------ctatctgaaatatgtgttg-cagatac
A0A4W2DYC0_BCL2A1-      aaagcaaaatggaggctgggtgtttacccataatgaatatca-aaagtcc
A0A4W2DYC0_BCL2A1-      ------------------ggtgtttacccataatgaatatca-aaagtcc
A0A4W2EB77_BCL2L10      -----------------------------------ggagc-----gcacc
E1B9B3_BCL2L10-01       -----------------------------------ggagc-----gcacc
F1MV39_BCL2L10-01       -----------------------------------ggagc-----gcacc
A0A4W2C0F3_BCL2L10      -----------------------------------ggagc-----gcacc
A0A4W2FG99_BCL2L10      -----------------------------------ggagc-----gcacc
A0A4W2GX13_BCL2L1-      -----------------------tttcccagaaaggatacagctggagtc
Q05KJ0_BCL2L1-01        -----------------------tttcccagaaaggatacagctggagtc
Q05KJ0_BCL2L1-02        -----------------------tttcccagaaaggatacagctggagtc
A0A3Q1LRT3_BCL2L1-      -----------------------tttcccagaaaggatacagctggagtc
A0A4W2D608_BCL2L1-      -----------------------tttcccagaaaggatacagctggagtc
A0A4W2F845_BCL2L1-      -----------------------tttcccagaaaggatacagctggagtc
A0A4W2D770_MCL1-01      -----------------------g-----------caggcaaccggcgcc
A5PJR2_MCL1-01          -----------------------g-----------caggcaaccggcgcc
A0A4W2D770_MCL1-02      -------------------------------------ggcaaccggcgcc
F1MQX4_MCL1-01          -----------------------g-----------caggcaaccggcgcc
A0A4W2CQV1_MCL1-01      -----------------------g-----------caggcaaccggcgcc
A0A4W2G6Q5_MCL1-01      -----------------------g-----------caggcaaccggcgcc
A0A4W2BWN1_BCL2-02      -----------------------t-----------gtcgcag-cggggct
A0A4W2BWN1_BCL2-01      -----------------------t-----------gtcgcag-cggggct
F6R2C4_BCL2-01          -----------------------t-----------gtcgcag-cggggct
O02718_BCL2-01          -----------------------t-----------gtcgcag-cggggct
A0A4W2D6A3_BCL2L2-      -----------------------c-----------ggggcgg-cggcgcc
A0A4W2GUJ7_BCL2L2-      -----------------------c-----------ggggcgg-cggcgcc
A0A4W2GUJ7_BCL2L2-      -----------------------t-----------gaggcag-aaggggt
A0A4W2D6A3_BCL2L2-      -----------------------t-----------gaggcag-aaggggt
A0A4W2GUJ7_BCL2L2-      -----------------------t-----------gaggcag-aaggggt
A0A4W2GUJ7_BCL2L2-      -----------------------t-----------gaggcag-aaggggt
A0A4W2D6A3_BCL2L2-      -----------------------t-----------gaggcag-aaggggt
A0A4W2D6A3_BCL2L2-      -----------------------t-----------gaggcag-aaggggt
A0A4W2GUJ7_BCL2L2-      -----------------------t-----------gaggcag-aaggggt
A0A4W2GUJ7_BCL2L2-      -----------------------t-----------gaggcag-aaggggt
Q1RMX3_BCL2L2-01        -----------------------t-----------gaggcag-aaggggt
Q05KI8_BCL2L2-01        -----------------------t-----------gaggcag-aaggggt
                                                                          

A0A4W2DYC0_BCL2A1-      agcaacctg--------------------------gatccaagccaagca
Q3C2I0_BCL2A1-01        agcaacctg--------------------------gatccaagccaagca
A0A4W2DYC0_BCL2A1-      aaaagagtgtccatctttctgagcatgccagatgaaattgagacagagga
A0A4W2DYC0_BCL2A1-      aaaagagtgtccatctttctgagcatgccagatgaaattgagacagagga
A0A4W2EB77_BCL2L10      gcccggctg-------------------ctgatggactacctggagttct
E1B9B3_BCL2L10-01       gcccggctg-------------------ctgatggactacctggagttct
F1MV39_BCL2L10-01       gcccggctg-------------------ctgatggactacctggagttct
A0A4W2C0F3_BCL2L10      gcccggctg-------------------ctgatggactacctggagttct
A0A4W2FG99_BCL2L10      gcccggctg-------------------ctgatggactacctggagttct
A0A4W2GX13_BCL2L1-      agtttagtg-------------------atgtggaagagaacagaactga
Q05KJ0_BCL2L1-01        agtttagtg-------------------atgtggaagagaacagaactga
Q05KJ0_BCL2L1-02        agtttagtg-------------------atgtggaagagaacagaactga
A0A3Q1LRT3_BCL2L1-      agtttagtg-------------------t------------cagatatgg
A0A4W2D608_BCL2L1-      agtttagtg-------------------gtatgaaagaacacagaactga
A0A4W2F845_BCL2L1-      agtttagtg-------------------t------------cagatatgg
A0A4W2D770_MCL1-01      aaggacgcg-------------------aag-------------------
A5PJR2_MCL1-01          aaggacgcg-------------------aag-------------------
A0A4W2D770_MCL1-02      aaggacgcg-------------------aag-------------------
F1MQX4_MCL1-01          aaggatgtg-------------------aag-------------------
A0A4W2CQV1_MCL1-01      aaggatgtg-------------------aag-------------------
A0A4W2G6Q5_MCL1-01      aaggatgtg-------------------aag-------------------
A0A4W2BWN1_BCL2-02      acgagtggg-------------------atgccggagacgcgggcgccgc
A0A4W2BWN1_BCL2-01      acgagtggg-------------------atgccggagacgcgggcgccgc
F6R2C4_BCL2-01          acgagtggg-------------------atgccggagacgcgggcgccgc
O02718_BCL2-01          acgagtggg-------------------atgccggagacgcgggcgccgc
A0A4W2D6A3_BCL2L2-      at-cttgtg-------------------cccgggg---------------
A0A4W2GUJ7_BCL2L2-      at-cttgtg-------------------cccgggg---------------
A0A4W2GUJ7_BCL2L2-      atgtttgtg-------------------gagctgg---------------
A0A4W2D6A3_BCL2L2-      atgtttgtg-------------------gagctgg---------------
A0A4W2GUJ7_BCL2L2-      atgtttgtg-------------------gagctgg---------------
A0A4W2GUJ7_BCL2L2-      atgtttgtg-------------------gagctgg---------------
A0A4W2D6A3_BCL2L2-      atgtttgtg-------------------gagctgg---------------
A0A4W2D6A3_BCL2L2-      atgtttgtg-------------------gagctgg---------------
A0A4W2GUJ7_BCL2L2-      atgtttgtg-------------------gagctgg---------------
A0A4W2GUJ7_BCL2L2-      atgtttgtg-------------------gagctgg---------------
Q1RMX3_BCL2L2-01        atgtttgtg-------------------gagctgg---------------
Q05KI8_BCL2L2-01        atgtttgtg-------------------gagctgg---------------
                                *                                         

A0A4W2DYC0_BCL2A1-      aaacatcc--agggtgtt-----acaagatg-------------------
Q3C2I0_BCL2A1-01        aaacatcc--agggtgtt-----acaagatg-------------------
A0A4W2DYC0_BCL2A1-      gatcatca--aggacattttccgacaaggca-------------------
A0A4W2DYC0_BCL2A1-      gatcatca--aggacattttccgacaaggca-------------------
A0A4W2EB77_BCL2L10      gcgccc----ggga---------gccgggcactc----------------
E1B9B3_BCL2L10-01       gcgccc----ggga---------gccgggcactc----------------
F1MV39_BCL2L10-01       gcgccc----ggga---------gccgggcactc----------------
A0A4W2C0F3_BCL2L10      gcgccc----ggga---------gccgggcactc----------------
A0A4W2FG99_BCL2L10      gcgccc----ggga---------gccgggcactc----------------
A0A4W2GX13_BCL2L1-      ggccccagaagggacagaatcagatatggaaacccccagtgccatcaatg
Q05KJ0_BCL2L1-01        ggccccagaagggacagaatcagatatggaaacccccagtgccatcaatg
Q05KJ0_BCL2L1-02        ggccccagaagggacagaatcagatatggaaacccccagtgccatcaatg
A0A3Q1LRT3_BCL2L1-      aaacccccagtgga-----tcag---tggcaacc----------------
A0A4W2D608_BCL2L1-      gaccccagaagggagagagtcagatatggaaacc----------------
A0A4W2F845_BCL2L1-      aaacccccagtgga-----tcag---tggcaacc----------------
A0A4W2D770_MCL1-01      ---cccct--gggcgg-------gtctggga-------------------
A5PJR2_MCL1-01          ---cccct--gggcgg-------gtctggga-------------------
A0A4W2D770_MCL1-02      ---cccct--gggcgg-------gtctggga-------------------
F1MQX4_MCL1-01          ---cccct--gggcgg-------gtctgggg-------------------
A0A4W2CQV1_MCL1-01      ---cccct--gggcag-------gtctgggg-------------------
A0A4W2G6Q5_MCL1-01      ---cccct--gggcgg-------gtctgggg-------------------
A0A4W2BWN1_BCL2-02      gccccccg--gggccgctcccgcgccgggcatcc--------------tg
A0A4W2BWN1_BCL2-01      gccccccg--gggccgctcccgcgccgggcatcc--------------tg
F6R2C4_BCL2-01          gccccccg--gggccgctcccgcgccgggcatcc--------------tg
O02718_BCL2-01          gccccccg--gggccgctcccgcgccgggcatcc--------------tg
A0A4W2D6A3_BCL2L2-      ---ccggt--ggggag-------gccgggga-------------------
A0A4W2GUJ7_BCL2L2-      ---ccggt--ggggag-------gccgggga-------------------
A0A4W2GUJ7_BCL2L2-      ---ccccg--gggagg-------gcccagca-------------------
A0A4W2D6A3_BCL2L2-      ---ccccg--gggagg-------gcccagca-------------------
A0A4W2GUJ7_BCL2L2-      ---ccccg--gggagg-------gcccagca-------------------
A0A4W2GUJ7_BCL2L2-      ---ccccg--gggagg-------gcccagca-------------------
A0A4W2D6A3_BCL2L2-      ---ccccg--gggagg-------gcccagca-------------------
A0A4W2D6A3_BCL2L2-      ---ccccg--gggagg-------gcccagca-------------------
A0A4W2GUJ7_BCL2L2-      ---ccccg--gggagg-------gcccagca-------------------
A0A4W2GUJ7_BCL2L2-      ---ccccg--gggagg-------gcccagca-------------------
Q1RMX3_BCL2L2-01        ---ccccg--gggagg-------gcccagca-------------------
Q05KI8_BCL2L2-01        ---ccccg--gggagg-------gcccagca-------------------
                           *       **                                     

A0A4W2DYC0_BCL2A1-      ---------------------------------------------tggct
Q3C2I0_BCL2A1-01        ---------------------------------------------tggct
A0A4W2DYC0_BCL2A1-      ---------------------------------------------aaacc
A0A4W2DYC0_BCL2A1-      ---------------------------------------------aaacc
A0A4W2EB77_BCL2L10      -------------------------------------cagctcctgcgcc
E1B9B3_BCL2L10-01       -------------------------------------cagctcctgcgcc
F1MV39_BCL2L10-01       -------------------------------------cagctcctgcgcc
A0A4W2C0F3_BCL2L10      -------------------------------------cagttcctgcgcc
A0A4W2FG99_BCL2L10      -------------------------------------cagctcctgcgcc
A0A4W2GX13_BCL2L1-      gcaacgcatcctggcacctggcggatagccctgctgtgaatggagccact
Q05KJ0_BCL2L1-01        gcaacgcatcctggcacctggcggatagccctgctgtgaatggagccact
Q05KJ0_BCL2L1-02        gcaacgcatcctggcacctggcggatagccctgctgtgaatggagccact
A0A3Q1LRT3_BCL2L1-      ------catcctggcacctggcagatagccccacagtgaatggagccact
A0A4W2D608_BCL2L1-      ------c--------------ccaatagccccacagtgaatggagccact
A0A4W2F845_BCL2L1-      ------catcctggcacctggcagatagccccacagtgaatggagccact
A0A4W2D770_MCL1-01      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      tcctcccagccgggccgcacacccgcgccctccaggacctccccgccgcc
A0A4W2BWN1_BCL2-01      tcctcccagccgggccgcacacccgcgccctccaggacctccccgccgcc
F6R2C4_BCL2-01          tcctcccagccgggccgcacacccgcgccctccaggacctccccgccgcc
O02718_BCL2-01          tcctcccagccgggccgcacacccgccccctccaggacctccccgccgcc
A0A4W2D6A3_BCL2L2-      -----------------------------------------------ggg
A0A4W2GUJ7_BCL2L2-      -----------------------------------------------ggg
A0A4W2GUJ7_BCL2L2-      -----------------------------------------------gct
A0A4W2D6A3_BCL2L2-      -----------------------------------------------gct
A0A4W2GUJ7_BCL2L2-      -----------------------------------------------gct
A0A4W2GUJ7_BCL2L2-      -----------------------------------------------gct
A0A4W2D6A3_BCL2L2-      -----------------------------------------------gct
A0A4W2D6A3_BCL2L2-      -----------------------------------------------gct
A0A4W2GUJ7_BCL2L2-      -----------------------------------------------gct
A0A4W2GUJ7_BCL2L2-      -----------------------------------------------gct
Q1RMX3_BCL2L2-01        -----------------------------------------------gct
Q05KI8_BCL2L2-01        -----------------------------------------------gct
                                                                          

A0A4W2DYC0_BCL2A1-      tcctctgtc-------------------------------caggacgaag
Q3C2I0_BCL2A1-01        tcctctgtc-------------------------------caggacgaag
A0A4W2DYC0_BCL2A1-      tgctttatcc----------------------------cgcggtaccagt
A0A4W2DYC0_BCL2A1-      tgctttatcc----------------------------cgcggtaccagt
A0A4W2EB77_BCL2L10      gtccacgcctgaggctgccgtgc---------------tgcgccacgtgg
E1B9B3_BCL2L10-01       gtccacgcctgaggctgccgtgc---------------tgcgccacgtgg
F1MV39_BCL2L10-01       gtccacgcctgaggctgccgtgc---------------tgcgccacgtgg
A0A4W2C0F3_BCL2L10      gtccacgcctgaggctgccgtgc---------------tgcgccacgtgg
A0A4W2FG99_BCL2L10      gtccacgcctgaggctgccgtgc---------------tgcgccacgtgg
A0A4W2GX13_BCL2L1-      ggccacagcagaagctcggatgcccgggaagtgatccccatggca-gcgg
Q05KJ0_BCL2L1-01        ggccacagcagaagctcggatgcccgggaagtgatccccatggca-gcgg
Q05KJ0_BCL2L1-02        ggccacagcagaagctcggatgcccgggaagtgatccccatggca-gcgg
A0A3Q1LRT3_BCL2L1-      ggccacagcagaagcttggatgcccggaaaatgatccccatgaca-acag
A0A4W2D608_BCL2L1-      ggccacagcagaagcttggatgcccggaaaatgatccccatgaca-acag
A0A4W2F845_BCL2L1-      ggccacagcagaagcttggatgcccggaaaatgatccccatgaca-acag
A0A4W2D770_MCL1-01      -ccacaagccgg----------------------------------aagg
A5PJR2_MCL1-01          -ccacaagccgg----------------------------------aagg
A0A4W2D770_MCL1-02      -ccacaagccgg----------------------------------aagg
F1MQX4_MCL1-01          -ccaccagccgg----------------------------------aagg
A0A4W2CQV1_MCL1-01      -ccaccagccgg----------------------------------aagg
A0A4W2G6Q5_MCL1-01      -ccaccagccgg----------------------------------aagg
A0A4W2BWN1_BCL2-02      gcccccggccgccgccgccgggcctgcgcccagcccggtgccgcctgtgg
A0A4W2BWN1_BCL2-01      gcccccggccgccgccgccgggcctgcgcccagcccggtgccgcctgtgg
F6R2C4_BCL2-01          gcccccggccgccgccgccgggcctgcgcccagcccggtgccgcctgtgg
O02718_BCL2-01          gcccccggccgccgccgccgggcctgcgcccagcccggtgccgcctgtgg
A0A4W2D6A3_BCL2L2-      ggccccgggggg--------------------------------------
A0A4W2GUJ7_BCL2L2-      ggccccgggggg--------------------------------------
A0A4W2GUJ7_BCL2L2-      gaccc-----gc--------------------------------------
A0A4W2D6A3_BCL2L2-      gaccc-----gc--------------------------------------
A0A4W2GUJ7_BCL2L2-      gaccc-----gc--------------------------------------
A0A4W2GUJ7_BCL2L2-      gaccc-----gc--------------------------------------
A0A4W2D6A3_BCL2L2-      gaccc-----gc--------------------------------------
A0A4W2D6A3_BCL2L2-      gaccc-----gc--------------------------------------
A0A4W2GUJ7_BCL2L2-      gaccc-----gc--------------------------------------
A0A4W2GUJ7_BCL2L2-      gaccc-----gc--------------------------------------
Q1RMX3_BCL2L2-01        gaccc-----gc--------------------------------------
Q05KI8_BCL2L2-01        gaccc-----gc--------------------------------------
                          *                                               

A0A4W2DYC0_BCL2A1-      tggaaaggactctgaagcagtgcttggataagtttga-------------
Q3C2I0_BCL2A1-01        tggaaaggactctgaagcagtgcttggataagtttga-------------
A0A4W2DYC0_BCL2A1-      tgcagagcaatc---------acatggatatggtgaa-------------
A0A4W2DYC0_BCL2A1-      tgcagagcaatc---------acatggatatggtgaa-------------
A0A4W2EB77_BCL2L10      ccgcacgtatccaggaagcaaatcgaaacgtctt----gcccctataccg
E1B9B3_BCL2L10-01       ccgcacgtatccaggaagcaaatcgaaacgtctt----gcccctataccg
F1MV39_BCL2L10-01       ccgcacgtatccaggaagcaaatcgaaatgtctt----gcccctataccg
A0A4W2C0F3_BCL2L10      ccgcacgtatccaggaagcaaatcgaaatgtctt----gcccctataccg
A0A4W2FG99_BCL2L10      ccgcacgtatccaggaagcaaatcgaaatgtctt----gcccctataccg
A0A4W2GX13_BCL2L1-      tgaagcaagccctgagggaggcaggcgatgagtttga-actgaggtaccg
Q05KJ0_BCL2L1-01        tgaagcaagccctgagggaggcaggcgatgagtttga-actgaggtaccg
Q05KJ0_BCL2L1-02        tgaagcaagccctgagggaggcaggcgatgagtttga-actgaggtaccg
A0A3Q1LRT3_BCL2L1-      taaagcaagccctgagggaggcaagcaatgagtttaa-actgaggtacca
A0A4W2D608_BCL2L1-      taaagcaagccctgagggaggcaagcaatgagtttaa-actttggtacca
A0A4W2F845_BCL2L1-      taaagcaagccctgagggaggcaagcaatgagtttaa-actgaggtacca
A0A4W2D770_MCL1-01      cgttggagaccctgcgccgagtcggggatggggtgca-gcgcaaccacga
A5PJR2_MCL1-01          cgttggagaccctgcgccgagtcggggatggggtgca-gcgcaaccacga
A0A4W2D770_MCL1-02      cgttggagaccctgcgccgagtcggggatggggtgca-gcgcaaccacga
F1MQX4_MCL1-01          cgttggagaccctgcaccgagtcggggatggggtgca-gcacaaccacga
A0A4W2CQV1_MCL1-01      cgttggagaccctgcaccgagtcggggatggggtgca-gcacaaccacga
A0A4W2G6Q5_MCL1-01      cgttggagaccctgcaccgagtcggggatggggtgca-gcacaaccacga
A0A4W2BWN1_BCL2-02      tgcacctgaccctgcgccaggccggcgatgacttctc-tcggcgctaccg
A0A4W2BWN1_BCL2-01      tgcacctgaccctgcgccaggccggcgatgacttctc-tcggcgctaccg
F6R2C4_BCL2-01          tgcacctgaccctgcgccaggccggcgatgacttctc-tcggcgctaccg
O02718_BCL2-01          tgcacctgaccctgcgccaggccggcgatgacttctc-tcggcgctaccg
A0A4W2D6A3_BCL2L2-      cgcaggggactacgggaacggcttg----gagtctgaggaactggagcct
A0A4W2GUJ7_BCL2L2-      cgcaggggactacgggaacggcttg----gagtctgaggaactggagcct
A0A4W2GUJ7_BCL2L2-      tacaccaagccatgcgggcagctggagatgagttcga-gacccgcttccg
A0A4W2D6A3_BCL2L2-      tacaccaagccatgcgggcagctggagatgagttcga-gacccgcttccg
A0A4W2GUJ7_BCL2L2-      tacaccaagccatgcgggcagctggagatgagttcga-gacccgcttccg
A0A4W2GUJ7_BCL2L2-      tacaccaagccatgcgggcagctggagatgagttcga-gacccgcttccg
A0A4W2D6A3_BCL2L2-      tacaccaagccatgcgggcagctggagatgagttcga-gacccgcttccg
A0A4W2D6A3_BCL2L2-      tacaccaagccatgcgggcagctggagatgagttcga-gacccgcttccg
A0A4W2GUJ7_BCL2L2-      tacaccaagccatgcgggcagctggagatgagttcga-gacccgcttccg
A0A4W2GUJ7_BCL2L2-      tacaccaagccatgcgggcagctggagatgagttcga-gacccgcttccg
Q1RMX3_BCL2L2-01        tacaccaagccatgcgggcagctggagatgagttcga-gacccgcttccg
Q05KI8_BCL2L2-01        tacaccaagccatgcgggcagctggagatgagttcga-gacccgcttccg
                                                                          

A0A4W2DYC0_BCL2A1-      tgtggtgtccgtaga-----------cactg-ccagaac-------aata
Q3C2I0_BCL2A1-01        tgtggtgtccgtaga-----------cactg-ccagaac-------aata
A0A4W2DYC0_BCL2A1-      gttagcatcgccagaggaaatcgctttgctgcccagaacttcctggaaca
A0A4W2DYC0_BCL2A1-      gttagcatcgccagaggaaatcgctttgctgcccagaacttcctggaaca
A0A4W2EB77_BCL2L10      cc-------------------------gctg-------ccgcaggcaccg
E1B9B3_BCL2L10-01       cc-------------------------gctg-------ccgcaggcaccg
F1MV39_BCL2L10-01       cc-------------------------gctg-------ccgcaggcaccg
A0A4W2C0F3_BCL2L10      cc-------------------------gctg-------ccgcaggcaccg
A0A4W2FG99_BCL2L10      cc-------------------------gctg-------ccgcaggcaccg
A0A4W2GX13_BCL2L1-      acgggcattcagcgacctgacgtcccagctccacatcaccccagggacag
Q05KJ0_BCL2L1-01        acgggcattcagcgacctgacgtcccagctccacatcaccccagggacag
Q05KJ0_BCL2L1-02        acgggcattcagcgacctgacgtcccagctccacatcaccccagggacag
A0A3Q1LRT3_BCL2L1-      acagacattcagcgacctgatgtcccagctccgcatcaccccagggacag
A0A4W2D608_BCL2L1-      acagacattcagcgacctgacgtcccagctccgcatcaccccagggacag
A0A4W2F845_BCL2L1-      acagacattcagcgacctgatgtcccagctccgcatcaccccagggacag
A0A4W2D770_MCL1-01      gacggctttccaaggcatgcttcggaaactg-----gacatcaaaaatga
A5PJR2_MCL1-01          gacggctttccaaggcatgcttcggaaactg-----gacatcaaaaatga
A0A4W2D770_MCL1-02      gacggctttccaaggcatgcttcggaaactg-----gacatcaaaaatga
F1MQX4_MCL1-01          gacggctttccaaggcatgcttcagaaactg-----gacatcaaaaacga
A0A4W2CQV1_MCL1-01      gacggctttccaaggcatgcttcagaaactg-----gacatcaaaaacga
A0A4W2G6Q5_MCL1-01      gacggctttccaaggcatgcttcagaaactg-----gacatcaaaaacga
A0A4W2BWN1_BCL2-02      ccgcgacttcgccgagatgtccagtcagctgcacctgacgcccttcaccg
A0A4W2BWN1_BCL2-01      ccgcgacttcgccgagatgtccagtcagctgcacctgacgcccttcaccg
F6R2C4_BCL2-01          ccgcgacttcgccgagatgtccagtcagctgcacctgacgcccttcaccg
O02718_BCL2-01          ccgcgacttcgccgagatgtccagtcagctgcacctgacgcccttcaccg
A0A4W2D6A3_BCL2L2-      gaggagctgct----gctggagcccgagccg-----gagcccgagcccga
A0A4W2GUJ7_BCL2L2-      gaggagctgct----gctggagcccgagccg-----gagcccgagcccga
A0A4W2GUJ7_BCL2L2-      gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
A0A4W2D6A3_BCL2L2-      gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
A0A4W2GUJ7_BCL2L2-      gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
A0A4W2GUJ7_BCL2L2-      gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
A0A4W2D6A3_BCL2L2-      gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
A0A4W2D6A3_BCL2L2-      gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
A0A4W2GUJ7_BCL2L2-      gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
A0A4W2GUJ7_BCL2L2-      gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
Q1RMX3_BCL2L2-01        gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
Q05KI8_BCL2L2-01        gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
                                                    *                     

A0A4W2DYC0_BCL2A1-      ttcaac----caagtg----------atggaaaaggaatt-t--gaaga-
Q3C2I0_BCL2A1-01        ttcaac----caagtg----------atggaaaaggaatt-t--gaaga-
A0A4W2DYC0_BCL2A1-      ttcagc----agcccg----------gtgaggatgaagttct--ggagg-
A0A4W2DYC0_BCL2A1-      ttcagc----agcccg----------gtgaggatgaagttct--ggagg-
A0A4W2EB77_BCL2L10      cgt-------cgagctggtggccaggatggcgcagaggctactcgacgaa
E1B9B3_BCL2L10-01       cgt-------cgagctggtggccaggatggcgcagaggctactcgacgaa
F1MV39_BCL2L10-01       cgt-------cgagctggtggccaggatggcgcagaggctactcgacgaa
A0A4W2C0F3_BCL2L10      cgt-------cgagctggtggccaggatggcgcagaggctactcgacgaa
A0A4W2FG99_BCL2L10      cgt-------cgagctggtggccaggatggcgcagaggctactcgacgaa
A0A4W2GX13_BCL2L1-      catatc----agagct-ttgaacag-gtagtgaatgaactcttccggga-
Q05KJ0_BCL2L1-01        catatc----agagct-ttgaacag-gtagtgaatgaactcttccggga-
Q05KJ0_BCL2L1-02        catatc----agagct-ttgaacag-gtagtgaatgaactcttccggga-
A0A3Q1LRT3_BCL2L1-      catgtc----agagct-ttgaacag-gtaataaatgaactcttccggga-
A0A4W2D608_BCL2L1-      catgtc----agagct-ttgaacag-gtaataaatgaactcttccggga-
A0A4W2F845_BCL2L1-      catgtc----agagct-ttgaacag-gtaataaatgaactcttccggga-
A0A4W2D770_MCL1-01      agacgatgtcaaatct-ttgtctcgagtgatggttcatgttttcagtga-
A5PJR2_MCL1-01          agacgatgtcaaatct-ttgtctcgagtgatggttcatgttttcagtga-
A0A4W2D770_MCL1-02      agacgatgtcaaatct-ttgtctcgagtgatggttcatgttttcagtga-
F1MQX4_MCL1-01          agacgatgttaaatct-ttgtctcgagtgatggttcatgttttcagtga-
A0A4W2CQV1_MCL1-01      agacgatgttaaatct-ttgtctcgagtgatggttcatgttttcagtga-
A0A4W2G6Q5_MCL1-01      agacgatgttaaatct-ttgtctcgagtgatggttcatgttttcagtga-
A0A4W2BWN1_BCL2-02      cgaggg----gacgct-tcgccacg-gtggtggaggagctcttcaggga-
A0A4W2BWN1_BCL2-01      cgaggg----gacgct-tcgccacg-gtggtggaggagctcttcaggga-
F6R2C4_BCL2-01          cgaggg----gacgct-tcgccacg-gtggtggaggagctcttcaggga-
O02718_BCL2-01          cgaggg----aacgct-tcgccacg-gtggtggaggagctcttcaggga-
A0A4W2D6A3_BCL2L2-      ---aga----ggagc---cgccccg-gcccc------gcgcccccccgg-
A0A4W2GUJ7_BCL2L2-      ---aga----ggagc---cgccccg-gcccc------gcgcccccccgg-
A0A4W2GUJ7_BCL2L2-      cccagc----aacgct-tcacccag-gtctctgatgaactcttccaagg-
A0A4W2D6A3_BCL2L2-      cccagc----aacgct-tcacccag-gtctctgatgaactcttccaagg-
A0A4W2GUJ7_BCL2L2-      cccagc----aacgct-tcacccag-gtctctgatgaactcttccaagg-
A0A4W2GUJ7_BCL2L2-      cccagc----aacgct-tcacccag-gtctctgatgaactcttccaagg-
A0A4W2D6A3_BCL2L2-      cccagc----aacgct-tcacccag-gtctctgatgaactcttccaagg-
A0A4W2D6A3_BCL2L2-      cccagc----aacgct-tcacccag-gtctctgatgaactcttccaagg-
A0A4W2GUJ7_BCL2L2-      cccagc----aacgct-tcacccag-gtctctgatgaactcttccaagg-
A0A4W2GUJ7_BCL2L2-      cccagc----aacgct-tcacccag-gtctctgatgaactcttccaagg-
Q1RMX3_BCL2L2-01        cccagc----aacgct-tcacccag-gtctctgatgaactcttccaagg-
Q05KI8_BCL2L2-01        cccagc----aacgct-tcacccag-gtctctgatgaactcttccaagg-
                                                                       *  

A0A4W2DYC0_BCL2A1-      -----tggcattgttaactggggcaggattgtaaccatattcgcctttga
Q3C2I0_BCL2A1-01        -----tggcattgttaactggggcaggattgtaaccatattcgcctttga
A0A4W2DYC0_BCL2A1-      -----aggccttgtcaacagggg--gacttgacctcatcttcgtgcc---
A0A4W2DYC0_BCL2A1-      -----aggccttgtcaacagggg--gacttgacctcatcttcgtgcc---
A0A4W2EB77_BCL2L10      gaccctggcc---ccagctggggccgcgtggcctcactcgtaaccttcgc
E1B9B3_BCL2L10-01       gaccctggcc---ccagctggggccgcgtggcctcactcgtaaccttcgc
F1MV39_BCL2L10-01       gaccctggcc---ccagctggggccgcgtggcctcactcgtgaccttcgc
A0A4W2C0F3_BCL2L10      gaccctggcc---ccagctggggccgcgtggcctcactcgtgaccttcgc
A0A4W2FG99_BCL2L10      gaccctggcc---ccagctggggccgcgtggcctcactcgtgaccttcgc
A0A4W2GX13_BCL2L1-      -----cgggg---tgaactggggtcgcattgtggcctttttctccttcgg
Q05KJ0_BCL2L1-01        -----cgggg---tgaactggggtcgcattgtggcctttttctccttcgg
Q05KJ0_BCL2L1-02        -----cgggg---tgaactggggtcgcattgtggcctttttctccttcgg
A0A3Q1LRT3_BCL2L1-      -----caggg---tgaaatggggtcacgttgtggcctttttctccttcag
A0A4W2D608_BCL2L1-      -----caggg---tgaagtggggtcacgttgtggcctttttctccttcag
A0A4W2F845_BCL2L1-      -----caggg---tgaagtggggtcacgttgtggcctttttctccttcag
A0A4W2D770_MCL1-01      -----cggagtaacaaactggggcaggattgtgactcttatttcttttgg
A5PJR2_MCL1-01          -----cggagtaacaaactggggcaggattgtgactcttatttcttttgg
A0A4W2D770_MCL1-02      -----cggagtaacaaactggggcaggattgtgactcttatttcttttgg
F1MQX4_MCL1-01          -----cagagtaacaaactggggcaggattgtgactcttatttcttttgg
A0A4W2CQV1_MCL1-01      -----cagagtaacaaactggggcaggattgtgactcttatttcttttgg
A0A4W2G6Q5_MCL1-01      -----cagagtaacaaactggggcaggattgtgactcttatttcttttgg
A0A4W2BWN1_BCL2-02      -----cgggg---tgaactgggggcgcatcgtggccttctttgagttcgg
A0A4W2BWN1_BCL2-01      -----cgggg---tgaactgggggcgcatcgtggccttctttgagttcgg
F6R2C4_BCL2-01          -----cgggg---tgaactgggggcgcatcgtggccttctttgagttcgg
O02718_BCL2-01          -----cgggg---tgaactgggggcgcatcgtggccttctttgagttcgg
A0A4W2D6A3_BCL2L2-      -----gagct---ccgg--------gccctg-ggcc-----tggctcggg
A0A4W2GUJ7_BCL2L2-      -----gagct---ccgg--------gccctg-ggcc-----tggctcggg
A0A4W2GUJ7_BCL2L2-      -----gggcc---ccaactggggccgccttgtggccttctttgtctttgg
A0A4W2D6A3_BCL2L2-      -----gggcc---ccaactggggccgccttgtggccttctttgtctttgg
A0A4W2GUJ7_BCL2L2-      -----gggcc---ccaactggggccgccttgtggccttctttgtctttgg
A0A4W2GUJ7_BCL2L2-      -----gggcc---ccaactggggccgccttgtggccttctttgtctttgg
A0A4W2D6A3_BCL2L2-      -----gggcc---ccaactggggccgccttgtggccttctttgtctttgg
A0A4W2D6A3_BCL2L2-      -----gggcc---ccaactggggccgccttgtggccttctttgtctttgg
A0A4W2GUJ7_BCL2L2-      -----gggcc---ccaactggggccgccttgtggccttctttgtctttgg
A0A4W2GUJ7_BCL2L2-      -----gggcc---ccaactggggccgccttgtggccttctttgtctttgg
Q1RMX3_BCL2L2-01        -----gggcc---ccaactggggccgccttgtggccttctttgtctttgg
Q05KI8_BCL2L2-01        -----gggcc---ccaactggggccgccttgtggccttctttgtctttgg
                               *                      *                   

A0A4W2DYC0_BCL2A1-      aggtattcttaccaagaaacttctgggcaagtgtattgcctcagacatgg
Q3C2I0_BCL2A1-01        aggtattcttaccaagaaacttctgggcaagtgtattgcctcagacatgg
A0A4W2DYC0_BCL2A1-      gggtctcgggttcgacaaa---cagagcaaccgtttgggacggggcaagg
A0A4W2DYC0_BCL2A1-      gggtctcgggttcgacaaa---cagagcaaccgtttgggacggggcaagg
A0A4W2EB77_BCL2L10      ggggtcg---------------ctg---------ctgg----agaggcca
E1B9B3_BCL2L10-01       ggggtcg---------------ctg---------ctgg----agaggcca
F1MV39_BCL2L10-01       ggggtcg---------------ctg---------ctgg----agaggccg
A0A4W2C0F3_BCL2L10      ggggtcg---------------ctg---------ctgg----agaggccg
A0A4W2FG99_BCL2L10      ggggtcg---------------ctg---------ctgg----agaggccg
A0A4W2GX13_BCL2L1-      tggggca---------------ctg------tgcgtgg----aaag----
Q05KJ0_BCL2L1-01        tggggca---------------ctg------tgcgtgg----aaag----
Q05KJ0_BCL2L1-02        tggggca---------------ctg------tgcgtgg----aaag----
A0A3Q1LRT3_BCL2L1-      tgggaca---------------cta------tgcatga----aaag----
A0A4W2D608_BCL2L1-      tgggaca---------------ata------tgcatga----aaag----
A0A4W2F845_BCL2L1-      tgggaca---------------cta------tgcatga----aaag----
A0A4W2D770_MCL1-01      tgccttt---------------gtggccaaacacttga----agag----
A5PJR2_MCL1-01          tgccttt---------------gtggccaaacacttga----agag----
A0A4W2D770_MCL1-02      tgccttt---------------gtggccaaacacttga----agag----
F1MQX4_MCL1-01          tgccttt---------------gtggccaaacacttta----agag----
A0A4W2CQV1_MCL1-01      tgccttt---------------gtggccaaacacttta----agag----
A0A4W2G6Q5_MCL1-01      tgccttt---------------gtggccaaacacttta----agag----
A0A4W2BWN1_BCL2-02      aggggtc---------------atg------tg-----------------
A0A4W2BWN1_BCL2-01      aggggtc---------------atg------tgtgtgg----agag----
F6R2C4_BCL2-01          aggggtc---------------atg------tgtgtgg----agag----
O02718_BCL2-01          aggggtc---------------atg------tgtgtgg----agag----
A0A4W2D6A3_BCL2L2-      agcccc--------------------------------------------
A0A4W2GUJ7_BCL2L2-      agcccc--------------------------------------------
A0A4W2GUJ7_BCL2L2-      agccgcg---------------ttg------tgtgctg----agag----
A0A4W2D6A3_BCL2L2-      agccgcg---------------ttg------tgtgctg----agag----
A0A4W2GUJ7_BCL2L2-      agccgcg---------------ttg------tgtgctg----agag----
A0A4W2GUJ7_BCL2L2-      agccgcg---------------ttg------tgtgctg----agag----
A0A4W2D6A3_BCL2L2-      agccgcg---------------ttg------tgtgctg----agag----
A0A4W2D6A3_BCL2L2-      agccgcg---------------ttg------tgtgctg----agag----
A0A4W2GUJ7_BCL2L2-      agccgcg---------------ttg------tgtgctg----agag----
A0A4W2GUJ7_BCL2L2-      agccgcg---------------ttg------tgtgctg----agag----
Q1RMX3_BCL2L2-01        agccgcg---------------ttg------tgtgctg----agag----
Q05KI8_BCL2L2-01        agccgcg---------------ttg------tgtgctg----agag----
                         *                                                

A0A4W2DYC0_BCL2A1-      acatgtgc---------------aaggacatttctttctttgtggcggag
Q3C2I0_BCL2A1-01        acatgtgc---------------aaggacatttctttctttgtggcggag
A0A4W2DYC0_BCL2A1-      gc---tac---------------tatgacgcctacct---------gaag
A0A4W2DYC0_BCL2A1-      gc---tac---------------tatgacgcctacct---------gaag
A0A4W2EB77_BCL2L10      ccgcagacgacccgacggcaggagaagagagacg-ac---------gacg
E1B9B3_BCL2L10-01       ccgcagacgacccgacggcaggagaagagagacg-ac---------gacg
F1MV39_BCL2L10-01       ccgcagactacccgacggc---agaagagagacg-ac---------gacg
A0A4W2C0F3_BCL2L10      ccgcagactacccgacggc---agaagagagacg-ac---------gacg
A0A4W2FG99_BCL2L10      ccgcagactacccgacggc---agaagagagacg-ac---------gacg
A0A4W2GX13_BCL2L1-      -cgtagac---------------aaggag------at---------gcag
Q05KJ0_BCL2L1-01        -cgtagac---------------aaggag------at---------gcag
Q05KJ0_BCL2L1-02        -cgtagac---------------aaggag------at---------gcag
A0A3Q1LRT3_BCL2L1-      -catagac---------------aaggag------at---------acac
A0A4W2D608_BCL2L1-      -catagac---------------aaggag------at---------acac
A0A4W2F845_BCL2L1-      -catagac---------------aaggag------at---------acac
A0A4W2D770_MCL1-01      -tataaat---------------caagaaagctgcat---------cgaa
A5PJR2_MCL1-01          -tataaat---------------caagaaagctgcat---------cgaa
A0A4W2D770_MCL1-02      -tataaat---------------caagaaagctgcat---------cgaa
F1MQX4_MCL1-01          -tataaat---------------caagaaagctgcat---------cgaa
A0A4W2CQV1_MCL1-01      -tataaat---------------caagaaagctgcat---------cgaa
A0A4W2G6Q5_MCL1-01      -tataaat---------------caagaaagctgcat---------cgaa
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      -cgtcaac---------------cgggag------at---------gtcg
F6R2C4_BCL2-01          -cgtcaac---------------cgggag------at---------gtcg
O02718_BCL2-01          -cgtcaac---------------cgggag------at---------gtcg
A0A4W2D6A3_BCL2L2-      -cggcaat---------------caggag------ga---------gga-
A0A4W2GUJ7_BCL2L2-      -cggcaat---------------caggag------ga---------gga-
A0A4W2GUJ7_BCL2L2-      -tgtcaac---------------aaggag------at---------ggag
A0A4W2D6A3_BCL2L2-      -tgtcaac---------------aaggag------at---------ggag
A0A4W2GUJ7_BCL2L2-      -tgtcaac---------------aaggag------at---------ggag
A0A4W2GUJ7_BCL2L2-      -tgtcaac---------------aaggag------at---------ggag
A0A4W2D6A3_BCL2L2-      -tgtcaac---------------aaggag------at---------ggag
A0A4W2D6A3_BCL2L2-      -tgtcaac---------------aaggag------at---------ggag
A0A4W2GUJ7_BCL2L2-      -tgtcaac---------------aaggag------at---------ggag
A0A4W2GUJ7_BCL2L2-      -tgtcaac---------------aaggag------at---------ggag
Q1RMX3_BCL2L2-01        -tgtcaac---------------aaggag------at---------ggag
Q05KI8_BCL2L2-01        -tgtcaac---------------aaggag------at---------ggag
                                                                          

A0A4W2DYC0_BCL2A1-      ttcatcaccgaaaatacaggagagtggataaagcaaaatggaggctggga
Q3C2I0_BCL2A1-01        ttcatcaccgaaaatacaggagagtggataaagcaaaatggaggctggga
A0A4W2DYC0_BCL2A1-      --cgttgtctgcagtcccaggacgtga--aaccctacaccctggcc----
A0A4W2DYC0_BCL2A1-      --cgttgtctgcagtcccaggacgtga--aaccctacaccctggcc----
A0A4W2EB77_BCL2L10      gcgttagcagggactgtcggctcctggtggcccttctgt-gtgctc----
E1B9B3_BCL2L10-01       gcgttagcagggactgtcggctcctggtggcccttctgt-gtgctc----
F1MV39_BCL2L10-01       gcgttagcagggactgtcggctcctggtggcccttctgt-gtgctc----
A0A4W2C0F3_BCL2L10      gcgttagcagggactgtcggctcctggtggcccttctgt-gtgctc----
A0A4W2FG99_BCL2L10      gcgttagcagggactgtcggctcctggtggcccttctgt-gtgctc----
A0A4W2GX13_BCL2L1-      gtattggtgagtcggatcgcaacttggatggccacttac-ctg-------
Q05KJ0_BCL2L1-01        gtattggtgagtcggatcgcaacttggatggccacttac-ctg-------
Q05KJ0_BCL2L1-02        gtattggtgagtcggatcgcaacttggatggccacttac-ctg-------
A0A3Q1LRT3_BCL2L1-      gtattggtgagtcaggtcacaacttcaacggccacttac-cta-------
A0A4W2D608_BCL2L1-      gtattggtgagtcaggtcacaacttcaatggccacttac-cta-------
A0A4W2F845_BCL2L1-      gtattggtgagtcaggtcacaacttcaacggccacttac-cta-------
A0A4W2D770_MCL1-01      ccactagcagaaagcat-----cacagatgttctcgtaaggtc-------
A5PJR2_MCL1-01          ccactagcagaaagcat-----cacagatgttctcgtaaggtc-------
A0A4W2D770_MCL1-02      ccactagcagaaagcat-----cacagatgttctcgtaaggtc-------
F1MQX4_MCL1-01          ccactagcagaaagcat-----cacagatgttctcgtaaggtc-------
A0A4W2CQV1_MCL1-01      ccactagcagaaagcat-----cacagatgttctcgtaaggtc-------
A0A4W2G6Q5_MCL1-01      ccactagcagaaagcat-----cacagatgttctcgtaaggtc-------
A0A4W2BWN1_BCL2-02      ----------------------tgtggatgaccgagtac-ctg-------
A0A4W2BWN1_BCL2-01      cccctggtggacagcatcgccctgtggatgaccgagtac-ctg-------
F6R2C4_BCL2-01          cccctggtggacagcatcgccctgtggatgaccgagtac-ctg-------
O02718_BCL2-01          cccctggtggacagcatcgccctgtggatgaccgagtac-ctg-------
A0A4W2D6A3_BCL2L2-      ---------ggaggagt-cgggactggtcgagggtgacc-cgg-------
A0A4W2GUJ7_BCL2L2-      ---------ggaggagt-cgggactggtcgagggtgacc-cgg-------
A0A4W2GUJ7_BCL2L2-      ccacttgtgggacaagtgcaggagtggatggtggcctac-ctg-------
A0A4W2D6A3_BCL2L2-      ccacttgtgggacaagtgcaggagtggatggtggcctac-ctg-------
A0A4W2GUJ7_BCL2L2-      ccacttgtgggacaagtgcaggagtggatggtggcctac-ctg-------
A0A4W2GUJ7_BCL2L2-      ccacttgtgggacaagtgcaggagtggatggtggcctac-ctg-------
A0A4W2D6A3_BCL2L2-      ccacttgtgggacaagtgcaggagtggatggtggcctac-ctg-------
A0A4W2D6A3_BCL2L2-      ccacttgtgggacaagtgcaggagtggatggtggcctac-ctg-------
A0A4W2GUJ7_BCL2L2-      ccacttgtgggacaagtgcaggagtggatggtggcctac-ctg-------
A0A4W2GUJ7_BCL2L2-      ccacttgtgggacaagtgcaggagtggatggtggcctac-ctg-------
Q1RMX3_BCL2L2-01        ccacttgtgggacaagtgcaggagtggatggtggcctac-ctg-------
Q05KI8_BCL2L2-01        ccacttgtgggacaagtgcaggagtggatggtggcctac-ctg-------
                                                                          

A0A4W2DYC0_BCL2A1-      aaatgggtttgtaaag---aagtttgaaaccaaatctggctggctgactt
Q3C2I0_BCL2A1-01        aaatgggtttgtaaag---aagtttgaaaccaaatctggctggctgactt
A0A4W2DYC0_BCL2A1-      ---ttggctttcaaagagcagatctgcctccaggtcccggtgaatgagaa
A0A4W2DYC0_BCL2A1-      ---ttggctttcaaagagcagatctgcctccaggtcccggtgaatgagaa
A0A4W2EB77_BCL2L10      ----agttctgcgaaaggcacc---gcgcctggctgatgactaacggcgg
E1B9B3_BCL2L10-01       ----agttctgcgaaaggcacc---gcgcctggctgatgactaacggcgg
F1MV39_BCL2L10-01       ----agttctgcgaaaggcacc---gcgcctggctgatggctaacggcgg
A0A4W2C0F3_BCL2L10      ----agttctgcgaaaggcacc---gcgcctggctgatggctaacggcgg
A0A4W2FG99_BCL2L10      ----agttctgcgaaaggcacc---gcgcctggctgatggctaacggcgg
A0A4W2GX13_BCL2L1-      ------------aatgaccacctagagccttggatccaggagaacggcgg
Q05KJ0_BCL2L1-01        ------------aatgaccacctagagccttggatccaggagaacggcgg
Q05KJ0_BCL2L1-02        ------------aatgaccacctagagccttggatccaggagaacggcgg
A0A3Q1LRT3_BCL2L1-      ------------aataaccacctcaagccttggatccaagagaacggcgg
A0A4W2D608_BCL2L1-      ------------aataaccacctcaagccttggatccaagagaacggcgg
A0A4W2F845_BCL2L1-      ------------aataaccacctcaagccttggatccaagagaacggcgg
A0A4W2D770_MCL1-01      ------------aaaacgagactggatagtcaaacaaa--------gagg
A5PJR2_MCL1-01          ------------aaaacgagactggatagtcaaacaaa--------gagg
A0A4W2D770_MCL1-02      ------------aaaacgagactggatagtcaaacaaa--------gagg
F1MQX4_MCL1-01          ------------aaaacgagactggatagtcaaagaaa--------gagg
A0A4W2CQV1_MCL1-01      ------------aaaacgagactggatagtcaaagaaa--------gagg
A0A4W2G6Q5_MCL1-01      ------------aaaacgagactggatagtcaaagaaa--------gagg
A0A4W2BWN1_BCL2-02      ------------aaccggcacctgcacacctggatccaggacaacggagg
A0A4W2BWN1_BCL2-01      ------------aaccggcacctgcacacctggatccaggacaacggagg
F6R2C4_BCL2-01          ------------aaccggcacctgcacacctggatccaggacaacggagg
O02718_BCL2-01          ------------aaccggcacctgcacacctggatccaggacaacggagg
A0A4W2D6A3_BCL2L2-      ------------gggacggcgc-------------------cattgagga
A0A4W2GUJ7_BCL2L2-      ------------gggacggcgc-------------------cattgagga
A0A4W2GUJ7_BCL2L2-      ------------gagacgaggctggctgactggatccacagcagtggggg
A0A4W2D6A3_BCL2L2-      ------------gagacgaggctggctgactggatccacagcagtggggg
A0A4W2GUJ7_BCL2L2-      ------------gagacgaggctggctgactggatccacagcagtggggg
A0A4W2GUJ7_BCL2L2-      ------------gagacgaggctggctgactggatccacagcagtggggg
A0A4W2D6A3_BCL2L2-      ------------gagacgaggctggctgactggatccacagcagtggggg
A0A4W2D6A3_BCL2L2-      ------------gagacgaggctggctgactggatccacagcagtggggg
A0A4W2GUJ7_BCL2L2-      ------------gagacgaggctggctgactggatccacagcagtggggg
A0A4W2GUJ7_BCL2L2-      ------------gagacgaggctggctgactggatccacagcagtggggg
Q1RMX3_BCL2L2-01        ------------gagacgaggctggctgactggatccacagcagtggggg
Q05KI8_BCL2L2-01        ------------gagacgaggctggctgactggatccacagcagtggggg
                                                                          

A0A4W2DYC0_BCL2A1-      ttc-----------------------------------------------
Q3C2I0_BCL2A1-01        ttc-----------------------------------------------
A0A4W2DYC0_BCL2A1-      tga-----------------------------------------------
A0A4W2DYC0_BCL2A1-      tga-----------------------------------------------
A0A4W2EB77_BCL2L10      ctg-----------------------------------------------
E1B9B3_BCL2L10-01       ctg----------------------------------------------g
F1MV39_BCL2L10-01       ctg-----------------------------------------------
A0A4W2C0F3_BCL2L10      ctg-----------------------------------------------
A0A4W2FG99_BCL2L10      ctg-----------------------------------------------
A0A4W2GX13_BCL2L1-      ctg-----------------------------------------------
Q05KJ0_BCL2L1-01        ctg-----------------------------------------------
Q05KJ0_BCL2L1-02        ctg-----------------------------------------------
A0A3Q1LRT3_BCL2L1-      gtg-----------------------------------------------
A0A4W2D608_BCL2L1-      gtg-----------------------------------------------
A0A4W2F845_BCL2L1-      gtg-----------------------------------------------
A0A4W2D770_MCL1-01      ctg-----------------------------------------------
A5PJR2_MCL1-01          ctg-----------------------------------------------
A0A4W2D770_MCL1-02      ctg-----------------------------------------------
F1MQX4_MCL1-01          ctg-----------------------------------------------
A0A4W2CQV1_MCL1-01      ctg-----------------------------------------------
A0A4W2G6Q5_MCL1-01      ctg-----------------------------------------------
A0A4W2BWN1_BCL2-02      ctg-----------------------------------------------
A0A4W2BWN1_BCL2-01      ctg-----------------------------------------------
F6R2C4_BCL2-01          ctg-----------------------------------------------
O02718_BCL2-01          ctg-----------------------------------------------
A0A4W2D6A3_BCL2L2-      ccc-----------------------------------------------
A0A4W2GUJ7_BCL2L2-      ccc-----------------------------------------------
A0A4W2GUJ7_BCL2L2-      ctg-----------------------------------------------
A0A4W2D6A3_BCL2L2-      ctg-----------------------------------------------
A0A4W2GUJ7_BCL2L2-      ctg-----------------------------------------------
A0A4W2GUJ7_BCL2L2-      ctggttctcccagaccagtgaagctgagatggttcatgaagtatttttcg
A0A4W2D6A3_BCL2L2-      ctg-----------------------------------------------
A0A4W2D6A3_BCL2L2-      ctg-----------------------------------------------
A0A4W2GUJ7_BCL2L2-      ctg-----------------------------------------------
A0A4W2GUJ7_BCL2L2-      ctg-----------------------------------------------
Q1RMX3_BCL2L2-01        ctg-----------------------------------------------
Q05KI8_BCL2L2-01        ctg-----------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       gtgagcgcgaaggacgcggggctggtgggcagcctgggacgcgcccacgc
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      -------------------------------------------------g
A0A4W2GUJ7_BCL2L2-      -------------------------------------------------g
A0A4W2GUJ7_BCL2L2-      -------------------------------------------------g
A0A4W2D6A3_BCL2L2-      -------------------------------------------------g
A0A4W2GUJ7_BCL2L2-      -------------------------------------------------g
A0A4W2GUJ7_BCL2L2-      gtgaaattttaagcaactgtgactctgctccaagttctcctgttcctgag
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      ----------------------------tg-gaagttacaggaaagatct
Q3C2I0_BCL2A1-01        ----------------------------tg-gaagttacaggaaagatct
A0A4W2DYC0_BCL2A1-      ----------------------------tgtgaaggtagacga-------
A0A4W2DYC0_BCL2A1-      ----------------------------tgtgaaggtagacga-------
A0A4W2EB77_BCL2L10      ----ggatggattttgtctcttcttc--ccactcattcca-ccatcttgg
E1B9B3_BCL2L10-01       tgccggatggattttgtctcttcttcagccactcattccagccatcttgg
F1MV39_BCL2L10-01       ----ggatggattttgtctctttttcagccagtcattccagccatcttgg
A0A4W2C0F3_BCL2L10      ----ggatggattttgtctctttttcagccagtcattccagccatcttgg
A0A4W2FG99_BCL2L10      ----ggatggattttgtctctttttcagccagtcattccagccatcttgg
A0A4W2GX13_BCL2L1-      -----ggacacttttgtggaactc----tacgggaaca-atgcagcagcc
Q05KJ0_BCL2L1-01        -----ggacacttttgtggaactc----tacgggaaca-atgcagcagcc
Q05KJ0_BCL2L1-02        -----ggacacttttgtggaactc----tacgggaaca-atgcagcagcc
A0A3Q1LRT3_BCL2L1-      -----ggacacttttgtggaactc----tacgaaagca-atacaacaaac
A0A4W2D608_BCL2L1-      -----ggacacttttgtggaactc----tacgaaagca-atacaacaaac
A0A4W2F845_BCL2L1-      -----ggacacttttgtggaactc----tacgaaagca-atacaacaaac
A0A4W2D770_MCL1-01      -----ggatgggtttgtggagttct-tccatgtaga-----ggacctaga
A5PJR2_MCL1-01          -----ggatgggtttgtggagttct-tccatgtaga-----ggacctaga
A0A4W2D770_MCL1-02      -----ggatgggtttgtggagttct-tccatgtaga-----ggacctaga
F1MQX4_MCL1-01          -----ggatgggtttgtggagttct-tccatgtaga-----ggacctaga
A0A4W2CQV1_MCL1-01      -----ggatgggtttgtggagttct-tccatgtaga-----ggacctaga
A0A4W2G6Q5_MCL1-01      -----ggatgggtttgtggagttct-tccatgtaga-----ggacctaga
A0A4W2BWN1_BCL2-02      -----------ggt--aggtgctcg---tctggatgtg---agtctgagc
A0A4W2BWN1_BCL2-01      -----------g-----gacgcctt---tgtggagctgtatggccctagc
F6R2C4_BCL2-01          -----------g-----gacgcctt---tgtggagctgtatggccctagc
O02718_BCL2-01          -----------g-----gacgcctt---tgtggagctgtatggccctagc
A0A4W2D6A3_BCL2L2-      gagctggaagcgat--caaagctcgagttagggagatg---ga-----gg
A0A4W2GUJ7_BCL2L2-      gagctggaagcgat--caaagctcgagttagggagatg---ga-----gg
A0A4W2GUJ7_BCL2L2-      gagctggaagcgat--caaagctcgagttagggagatg---ga-----gg
A0A4W2D6A3_BCL2L2-      gagctggaagcgat--caaagctcgagttagggagatg---ga-----gg
A0A4W2GUJ7_BCL2L2-      gagctggaagcgat--caaagctcgagttagggagatg---ga-----gg
A0A4W2GUJ7_BCL2L2-      gagctggaagcgat--caaagctcgagttagggagatg---ga-----gg
A0A4W2D6A3_BCL2L2-      -----ggcggagtt--cacagctcta--tacggggacg---gggccctgg
A0A4W2D6A3_BCL2L2-      -----ggcggagtt--cacagctcta--tacggggacg---gggccctgg
A0A4W2GUJ7_BCL2L2-      -----ggcggagtt--cacagctcta--tacggggacg---gggccctgg
A0A4W2GUJ7_BCL2L2-      -----ggcggagtt--cacagctcta--tacggggacg---gggccctgg
Q1RMX3_BCL2L2-01        -----ggcggagtt--cacagctcta--tacggggacg---gggccctgg
Q05KI8_BCL2L2-01        -----ggcggagtt--cacagctcta--tacggggtcg---gggccctgg
                                                                          

A0A4W2DYC0_BCL2A1-      gtgaaacattatgtcgcctgaag---------------------------
Q3C2I0_BCL2A1-01        gtgaaacattatgtcgcctgaag---------------------------
A0A4W2DYC0_BCL2A1-      --ggtgctttacg-------------------------------------
A0A4W2DYC0_BCL2A1-      --ggtgctttacg-------------------------------------
A0A4W2EB77_BCL2L10      gaaagacagctggtctggtttttcc-------------------------
E1B9B3_BCL2L10-01       gaaagacagctggtctggtttttcc-------------------------
F1MV39_BCL2L10-01       gaaagacagctggtctggtttttcc-------------------------
A0A4W2C0F3_BCL2L10      gaaagacagctggtctggtttttcc-------------------------
A0A4W2FG99_BCL2L10      gaaagacagctggtctggtttttcc-------------------------
A0A4W2GX13_BCL2L1-      gagagccggaagggccaggagcgct-------------------------
Q05KJ0_BCL2L1-01        gagagccggaagggccaggagcgct-------------------------
Q05KJ0_BCL2L1-02        gagagccggaagggccaggagcgct-------------------------
A0A3Q1LRT3_BCL2L1-      gagagccagaagggccaagagcgtt-------------------------
A0A4W2D608_BCL2L1-      gagagccagaagggccaggagcgct-------------------------
A0A4W2F845_BCL2L1-      gagagccagaagggccaagagtgtt-------------------------
A0A4W2D770_MCL1-01      aggcggcat-----------------------------------------
A5PJR2_MCL1-01          aggcggcat-----------------------------------------
A0A4W2D770_MCL1-02      aggcggcat-----------------------------------------
F1MQX4_MCL1-01          aggcggcat-----------------------------------------
A0A4W2CQV1_MCL1-01      aggcggcat-----------------------------------------
A0A4W2G6Q5_MCL1-01      aggcggcat-----------------------------------------
A0A4W2BWN1_BCL2-02      gggacacct-----cggt--------------------------------
A0A4W2BWN1_BCL2-01      atgcggccc-----ctgtttgattt-------------------------
F6R2C4_BCL2-01          atgcggccc-----ctgtttgattt-------------------------
O02718_BCL2-01          atgcggccc-----ctgtttgattt-------------------------
A0A4W2D6A3_BCL2L2-      aagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatg
A0A4W2GUJ7_BCL2L2-      aagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatg
A0A4W2GUJ7_BCL2L2-      aagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatg
A0A4W2D6A3_BCL2L2-      aagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatg
A0A4W2GUJ7_BCL2L2-      aagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatg
A0A4W2GUJ7_BCL2L2-      aagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatg
A0A4W2D6A3_BCL2L2-      aggaggcgcggcgtctgcgggag---------------gggaa-------
A0A4W2D6A3_BCL2L2-      aggaggcgcggcgtctgcgggag---------------gggaa-------
A0A4W2GUJ7_BCL2L2-      aggaggcgcggcgtctgcgggag---------------gggaa-------
A0A4W2GUJ7_BCL2L2-      aggaggcgcggcgtctgcgggag---------------gggaa-------
Q1RMX3_BCL2L2-01        aggaggcgcggcgtctgcgggag---------------gggaa-------
Q05KI8_BCL2L2-01        aggaggcgcggcgtctgcgggag---------------gggaa-------
                              *                                           

A0A4W2DYC0_BCL2A1-      --------------------------------------------caatac
Q3C2I0_BCL2A1-01        --------------------------------------------caatac
A0A4W2DYC0_BCL2A1-      ---------------------------------------------aagac
A0A4W2DYC0_BCL2A1-      ---------------------------------------------aagac
A0A4W2EB77_BCL2L10      --------tctcatactggacagcaataatcataatctacttctggataa
E1B9B3_BCL2L10-01       --------tctcatactggacagcaataatcataatctacttctggataa
F1MV39_BCL2L10-01       --------tcgcatactggacagcaataatcataatctacttctggataa
A0A4W2C0F3_BCL2L10      --------tcgcatactggacagcaataatcataatctacttctggataa
A0A4W2FG99_BCL2L10      --------tcgcatactggacagcaataatcataatctacttctggataa
A0A4W2GX13_BCL2L1-      -----------------------------tcaaccgctggttcctgacgg
Q05KJ0_BCL2L1-01        -----------------------------tcaaccgctggttcctgacgg
Q05KJ0_BCL2L1-02        -----------------------------tcaaccgctggttcctgacgg
A0A3Q1LRT3_BCL2L1-      -----------------------------tcaactgctggtccctgac-g
A0A4W2D608_BCL2L1-      -----------------------------tcaact--------ccatt-t
A0A4W2F845_BCL2L1-      -----------------------------tcaact--------ccatt-t
A0A4W2D770_MCL1-01      --------------------cagaaatgtgctgctggcttttgcaggtgt
A5PJR2_MCL1-01          --------------------cagaaatgtgctgctggcttttgcaggtgt
A0A4W2D770_MCL1-02      --------------------cagaaatgtgctgctggcttttgcaggtgt
F1MQX4_MCL1-01          --------------------cagaaatgtgctgctggcttttgcaggtgt
A0A4W2CQV1_MCL1-01      --------------------cagaaatgtgctgctggcttttgcaggtgt
A0A4W2G6Q5_MCL1-01      --------------------cagaaatgtgctgctggcttttgcaggtgt
A0A4W2BWN1_BCL2-02      ------------------------------------------cccagtgc
A0A4W2BWN1_BCL2-01      -------------ctcctggctgt----ctctgaaggcactgctcagtct
F6R2C4_BCL2-01          -------------ctcctggctgt----ctctgaaggcactgctcagtct
O02718_BCL2-01          -------------ctcctggctgt----ctctgaaggcactgctcagtct
A0A4W2D6A3_BCL2L2-      aatatgagtccacctccgggcaatgctggcccagtgatcatgtccattga
A0A4W2GUJ7_BCL2L2-      aatatgagtccacctccgggcaatgctggcccagtgatcatgtccattga
A0A4W2GUJ7_BCL2L2-      aatatgagtccacctccgggcaatgctggcccagtgatcatgtccattga
A0A4W2D6A3_BCL2L2-      aatatgagtccacctccgggcaatgctggcccagtgatcatgtccattga
A0A4W2GUJ7_BCL2L2-      aatatgagtccacctccgggcaatgctggcccagtgatcatgtccattga
A0A4W2GUJ7_BCL2L2-      aatatgagtccacctccgggcaatgctggcccagtgatcatgtccattga
A0A4W2D6A3_BCL2L2-      ---------------ctgggc---------------------ttcagtga
A0A4W2D6A3_BCL2L2-      ---------------ctgggc---------------------ttcagtga
A0A4W2GUJ7_BCL2L2-      ---------------ctgggc---------------------ttcagtga
A0A4W2GUJ7_BCL2L2-      ---------------ctgggc---------------------ttcagtga
Q1RMX3_BCL2L2-01        ---------------ctgggc---------------------ttcagtga
Q05KI8_BCL2L2-01        ---------------ctgggc---------------------ttcagtga
                                                                          

A0A4W2DYC0_BCL2A1-      tattga--------------------------------------------
Q3C2I0_BCL2A1-01        tattga--------------------------------------------
A0A4W2DYC0_BCL2A1-      tcctga--------------------------------------------
A0A4W2DYC0_BCL2A1-      tcctga--------------------------------------------
A0A4W2EB77_BCL2L10      aattat----cgtga-----------------------------------
E1B9B3_BCL2L10-01       aattat----cgtgagttctaaaattcttatttctacctgcctaactctg
F1MV39_BCL2L10-01       aattat----tgtga-----------------------------------
A0A4W2C0F3_BCL2L10      aattat----tgtga-----------------------------------
A0A4W2FG99_BCL2L10      aattat----tgtga-----------------------------------
A0A4W2GX13_BCL2L1-      gcatga---ctgtggctggtgtggttctgctgggctcgctcttca-----
Q05KJ0_BCL2L1-01        gcatga---ctgtggctggtgtggttctgctgggctcgctcttca-----
Q05KJ0_BCL2L1-02        gcatga---ctgtggctggtgtggttctgctgggctcgctcttca-----
A0A3Q1LRT3_BCL2L1-      acacga---ctgtggctgtttggcattttcttaa-------ttaaacata
A0A4W2D608_BCL2L1-      acacta---ctgctgctgtcgcaggcctcgcaaacctcatttcaaacaca
A0A4W2F845_BCL2L1-      acacta---ctgctgctgtcgcaggcctcacaaacctcatttcaaacaca
A0A4W2D770_MCL1-01      tgccgg----agtaggagctg------------------------gtttg
A5PJR2_MCL1-01          tgccgg----agtaggagctg------------------------gtttg
A0A4W2D770_MCL1-02      tgccgg----agtaggagctg------------------------gtttg
F1MQX4_MCL1-01          tgccgg----agtaggagctg------------------------gtttg
A0A4W2CQV1_MCL1-01      tgccgg----agtaggagctg------------------------gtttg
A0A4W2G6Q5_MCL1-01      tgccgg----agtaggagctg------------------------gtttg
A0A4W2BWN1_BCL2-02      ggtccg-agtggtggggtgtg------gctgggcccagggtcaagggcag
A0A4W2BWN1_BCL2-01      ggccc----tggtgggcgctt------gcatcaccctgggtgcctatctg
F6R2C4_BCL2-01          ggccc----tggtgggcgctt------gcatcaccctgggtgcctatctg
O02718_BCL2-01          ggccc----tggtgggcgctt------gcatcaccctgggtgcctatctg
A0A4W2D6A3_BCL2L2-      ggagaa----gatggaggctgatgcccgttccatctatgttggcaatgtg
A0A4W2GUJ7_BCL2L2-      ggagaa----gatggaggctgatgcccgttccatctatgttggcaatgtg
A0A4W2GUJ7_BCL2L2-      ggagaa----gatggaggctgatgcccgttccatctatgttggcaatgtg
A0A4W2D6A3_BCL2L2-      ggagaa----gatggaggctgatgcccgttccatctatgttggcaatgtg
A0A4W2GUJ7_BCL2L2-      ggagaa----gatggaggctgatgcccgttccatctatgttggcaatgtg
A0A4W2GUJ7_BCL2L2-      ggagaa----gatggaggctgatgcccgttccatctatgttggcaatgtg
A0A4W2D6A3_BCL2L2-      ggacagtgctgacgggggctg-------------------tggcactggg
A0A4W2D6A3_BCL2L2-      ggacagtgctgacgggggctg-------------------tggcactggg
A0A4W2GUJ7_BCL2L2-      ggacagtgctgacgggggctg-------------------tggcactggg
A0A4W2GUJ7_BCL2L2-      ggacagtgctgacgggggctg-------------------tggcactggg
Q1RMX3_BCL2L2-01        ggacagtgctgacgggggctg-------------------tggcactggg
Q05KI8_BCL2L2-01        ggacagtgctgacgggggctg-------------------tggcactggg
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       agcaaccaagcaaaattgaaatgtgaaagaccaaatcagagtaaaccacc
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------gtcgg-
Q05KJ0_BCL2L1-01        --------------------------------------------gtcgg-
Q05KJ0_BCL2L1-02        --------------------------------------------gtcgg-
A0A3Q1LRT3_BCL2L1-      ta--tttaccaaacaacccagcaattgtactcttgagcatttatctggg-
A0A4W2D608_BCL2L1-      aaactttattcaaaattagaccaaagatgcccata-----ctatgtgggc
A0A4W2F845_BCL2L1-      aaactttattcaaaattagaccaaagatgcccata-----ctatgtgggc
A0A4W2D770_MCL1-01      gcatatctaataagatag--------------------------------
A5PJR2_MCL1-01          gcatatctaataagatag--------------------------------
A0A4W2D770_MCL1-02      gcatatctaataagatag--------------------------------
F1MQX4_MCL1-01          gcatatctaataagatag--------------------------------
A0A4W2CQV1_MCL1-01      gcatatctaataagatag--------------------------------
A0A4W2G6Q5_MCL1-01      gcatatctaataagatag--------------------------------
A0A4W2BWN1_BCL2-02      gccggtggagtaa-------------------------------------
A0A4W2BWN1_BCL2-01      ggccat-aagtga-------------------------------------
F6R2C4_BCL2-01          ggccat-aagtga-------------------------------------
O02718_BCL2-01          ggccat-aag----------------------------------------
A0A4W2D6A3_BCL2L2-      gactatggtgcaacagcagaagagctagaagcacactttcatggctgtgg
A0A4W2GUJ7_BCL2L2-      gactatggtgcaacagcagaagagctagaagcacactttcatggctgtgg
A0A4W2GUJ7_BCL2L2-      gactatggtgcaacagcagaagagctagaagcacactttcatggctgtgg
A0A4W2D6A3_BCL2L2-      gactatggtgcaacagcagaagagctagaagcacactttcatggctgtgg
A0A4W2GUJ7_BCL2L2-      gactatggtgcaacagcagaagagctagaagcacactttcatggctgtgg
A0A4W2GUJ7_BCL2L2-      gactatggtgcaacagcagaagagctagaagcacactttcatggctgtgg
A0A4W2D6A3_BCL2L2-      ggccctggt-----------------------------------------
A0A4W2D6A3_BCL2L2-      ggccctggt-----------------------------------------
A0A4W2GUJ7_BCL2L2-      ggccctggt-----------------------------------------
A0A4W2GUJ7_BCL2L2-      ggccctggt-----------------------------------------
Q1RMX3_BCL2L2-01        ggccctggt-----------------------------------------
Q05KI8_BCL2L2-01        ggccctggt-----------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       ttccgagacatttttatctgcattcatgtaa-------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      ---------------aaatga-----------------------------
Q05KJ0_BCL2L1-01        ---------------aaatga-----------------------------
Q05KJ0_BCL2L1-02        ---------------aaatga-----------------------------
A0A3Q1LRT3_BCL2L1-      -----------agatacgcaacattactgtag------------------
A0A4W2D608_BCL2L1-      cactcaggctcagatagatga-----------------------------
A0A4W2F845_BCL2L1-      cactcaggctcagatagatga-----------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      ttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccga
A0A4W2GUJ7_BCL2L2-      ttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccga
A0A4W2GUJ7_BCL2L2-      ttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccga
A0A4W2D6A3_BCL2L2-      ttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccga
A0A4W2GUJ7_BCL2L2-      ttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccga
A0A4W2GUJ7_BCL2L2-      ttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccga
A0A4W2D6A3_BCL2L2-      -------------------------------aactgtaggggcctt----
A0A4W2D6A3_BCL2L2-      -------------------------------aactgtaggggcctt----
A0A4W2GUJ7_BCL2L2-      -------------------------------aactgtaggggcctt----
A0A4W2GUJ7_BCL2L2-      -------------------------------aactgtaggggcctt----
Q1RMX3_BCL2L2-01        -------------------------------aactgtaggggcctt----
Q05KI8_BCL2L2-01        -------------------------------aactgtaggggcctt----
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      aagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttcc
A0A4W2GUJ7_BCL2L2-      aagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttcc
A0A4W2GUJ7_BCL2L2-      aagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttcc
A0A4W2D6A3_BCL2L2-      aagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttcc
A0A4W2GUJ7_BCL2L2-      aagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttcc
A0A4W2GUJ7_BCL2L2-      aagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttcc
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      ctggccttagatgaatccttatttagaggaagacagatcaaggtgatccc
A0A4W2GUJ7_BCL2L2-      ctggccttagatgaatccttatttagaggaagacagatcaaggtgatccc
A0A4W2GUJ7_BCL2L2-      ctggccttagatgaatccttatttagaggaagacagatcaaggtgatccc
A0A4W2D6A3_BCL2L2-      ctggccttagatgaatccttatttagaggaagacagatcaaggtgatccc
A0A4W2GUJ7_BCL2L2-      ctggccttagatgaatccttatttagaggaagacagatcaaggtgatccc
A0A4W2GUJ7_BCL2L2-      ctggccttagatgaatccttatttagaggaagacagatcaaggtgatccc
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      taaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccac
A0A4W2GUJ7_BCL2L2-      taaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccac
A0A4W2GUJ7_BCL2L2-      taaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccac
A0A4W2D6A3_BCL2L2-      taaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccac
A0A4W2GUJ7_BCL2L2-      taaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccac
A0A4W2GUJ7_BCL2L2-      taaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccac
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      gagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcga
A0A4W2GUJ7_BCL2L2-      gagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcga
A0A4W2GUJ7_BCL2L2-      gagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcga
A0A4W2D6A3_BCL2L2-      gagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcga
A0A4W2GUJ7_BCL2L2-      gagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcga
A0A4W2GUJ7_BCL2L2-      gagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcga
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2EB77_BCL2L10      --------------------------------------------------
E1B9B3_BCL2L10-01       --------------------------------------------------
F1MV39_BCL2L10-01       --------------------------------------------------
A0A4W2C0F3_BCL2L10      --------------------------------------------------
A0A4W2FG99_BCL2L10      --------------------------------------------------
A0A4W2GX13_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2D770_MCL1-01      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A4W2D770_MCL1-02      --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2BWN1_BCL2-02      --------------------------------------------------
A0A4W2BWN1_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A4W2D6A3_BCL2L2-      ttctacagtggttttaacagcaggccccggggtcgcgtctaca--ggtca
A0A4W2GUJ7_BCL2L2-      ttctacagtggttttaacagcaggccccggggtcgcgtctaca--ggtca
A0A4W2GUJ7_BCL2L2-      ttctacagtggttttaacagcaggccccggggtcgcgtctaca--ggtca
A0A4W2D6A3_BCL2L2-      ttctacagtggttttaacagcaggccccggggtcgcgtctacaggggccg
A0A4W2GUJ7_BCL2L2-      ttctacagtggttttaacagcaggccccggggtcgcgtctacaggggccg
A0A4W2GUJ7_BCL2L2-      ttctacagtggttttaacagcaggccccggggtcgcgtctacaggggccg
A0A4W2D6A3_BCL2L2-      -----------ttttgctagcaag--------------------------
A0A4W2D6A3_BCL2L2-      -----------ttttgctagcaag--------------------------
A0A4W2GUJ7_BCL2L2-      -----------ttttgctagcaag--------------------------
A0A4W2GUJ7_BCL2L2-      -----------ttttgctagcaag--------------------------
Q1RMX3_BCL2L2-01        -----------ttttgctagcaag--------------------------
Q05KI8_BCL2L2-01        -----------ttttgctagcaag--------------------------
                                                                          

A0A4W2DYC0_BCL2A1-      ----------------------------------
Q3C2I0_BCL2A1-01        ----------------------------------
A0A4W2DYC0_BCL2A1-      ----------------------------------
A0A4W2DYC0_BCL2A1-      ----------------------------------
A0A4W2EB77_BCL2L10      ----------------------------------
E1B9B3_BCL2L10-01       ----------------------------------
F1MV39_BCL2L10-01       ----------------------------------
A0A4W2C0F3_BCL2L10      ----------------------------------
A0A4W2FG99_BCL2L10      ----------------------------------
A0A4W2GX13_BCL2L1-      ----------------------------------
Q05KJ0_BCL2L1-01        ----------------------------------
Q05KJ0_BCL2L1-02        ----------------------------------
A0A3Q1LRT3_BCL2L1-      ----------------------------------
A0A4W2D608_BCL2L1-      ----------------------------------
A0A4W2F845_BCL2L1-      ----------------------------------
A0A4W2D770_MCL1-01      ----------------------------------
A5PJR2_MCL1-01          ----------------------------------
A0A4W2D770_MCL1-02      ----------------------------------
F1MQX4_MCL1-01          ----------------------------------
A0A4W2CQV1_MCL1-01      ----------------------------------
A0A4W2G6Q5_MCL1-01      ----------------------------------
A0A4W2BWN1_BCL2-02      ----------------------------------
A0A4W2BWN1_BCL2-01      ----------------------------------
F6R2C4_BCL2-01          ----------------------------------
O02718_BCL2-01          ----------------------------------
A0A4W2D6A3_BCL2L2-      ggatag----------------------------
A0A4W2GUJ7_BCL2L2-      ggatag----------------------------
A0A4W2GUJ7_BCL2L2-      ggatag----------------------------
A0A4W2D6A3_BCL2L2-      ggctagagcgacatcatggtattccccttactaa
A0A4W2GUJ7_BCL2L2-      ggctagagcgacatcatggtattccccttactaa
A0A4W2GUJ7_BCL2L2-      ggctagagcgacatcatggtattccccttactaa
A0A4W2D6A3_BCL2L2-      -------------------------------tga
A0A4W2D6A3_BCL2L2-      -------------------------------tga
A0A4W2GUJ7_BCL2L2-      -------------------------------tga
A0A4W2GUJ7_BCL2L2-      -------------------------------tga
Q1RMX3_BCL2L2-01        -------------------------------tga
Q05KI8_BCL2L2-01        -------------------------------tga
                                                          

© 1998-2022Legal notice