Dataset for CDS BCL-2-like of organism Pan troglodytes

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A2I3RTV4_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=378 residues).
agtgttgaaacgtgcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatcca
tgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttga
agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactgg
ctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgct
gctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I3RTV4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I3RTV4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I3RTV4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|G2HFR3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=444 residues).
atggacatttgccggctctcagcagcaatgcgtgaattttacattgtgcatctggatatatacccaccacctgagtgtac
cattcacatgttactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacg
gcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaa
gaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaag
aggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcag
gtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|H2Q805_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L2 (length=813 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggaccaagaggaggaggaggagccgggactggtcgagggtgacccgggggacggcgccattgaggac
ccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaagctaaaggagctacagaacgaggt
agagaagcagatgaatatgagtccaccaccaggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
atgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaagctcactttcatggctgtggt
tcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgcgtatatagagttctcagacaa
agagtcagtgaggacttccttggccttagatgagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaacca
acagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgcccggaccaccaactacaacagttcc
cgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggta
ttccccttactaa
>gnl|bcl2dbcds|H2Q805_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|H2Q805_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|H2Q805_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggttcgggagcccccggcagccaagaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
ggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccg
cgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|H2Q9G4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgtgagcgcaccaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagatccaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccacccggtggaagaagtggggcttccagccgcggctaaatgagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|H2QEM8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pan troglodytes GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
© 1998-2020Legal notice