Dataset for CDS BCL-2-like of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

15 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3RA26_BCL2A1-      -gtggc--------------------------------------------
A0A2I3RA26_BCL2A1-      -atgacaga-----------------------------------------
A0A2I3RA26_BCL2A1-      -atgacaga-----------------------------------------
A0A2I3RA26_BCL2A1-      -atgacaga-----------------------------------------
H2Q805_BCL2L2-03        -atggcgg------------------------------------------
H2Q805_BCL2L2-04        -atggcgg------------------------------------------
H2Q805_BCL2L2-01        -atggcga------------------------------------------
H2Q805_BCL2L2-02        -atggcga------------------------------------------
H2QEM8_BCL2-01          -atggcgcacgctgggagaacagggtacgataaccggga--gatagtgat
H2Q9G4_BCL2L10-01       -atggttg------------------------------accagtggcgtg
G2HFR3_MCL1-01          -atg-------------gacat----------------------------
A0A2I3RTV4_MCL1-04      agtgtt-----------gaaacgtg-------------------------
A0A2I3RTV4_MCL1-02      -atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtg
A0A2I3RTV4_MCL1-01      -atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtg
A0A2I3RTV4_MCL1-03      -atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtg
                          **                                              

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      ------------------------------------------------ct
A0A2I3RA26_BCL2A1-      ------------------------------------------------ct
A0A2I3RA26_BCL2A1-      ------------------------------------------------ct
H2Q805_BCL2L2-03        --------------------cggcggcggcggcggcagcagcag----cg
H2Q805_BCL2L2-04        --------------------cggcggcggcggcggcagcagcag----cg
H2Q805_BCL2L2-01        --------------------ccccagcctcagccccagacaca-----cg
H2Q805_BCL2L2-02        --------------------ccccagcctcagccccagacaca-----cg
H2QEM8_BCL2-01          gaagtacatccatta-taagctgtcgcagaggggctacgagtgggatgcg
H2Q9G4_BCL2L10-01       agcgcaccaccatggccgacccgctgcgggagcgcacc----------ga
G2HFR3_MCL1-01          -----------ttgc-cggctctcagcagcaatgc---------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      ggggggccggcttgg-gggccggcagcggcggcgccacccctccgggagg
A0A2I3RTV4_MCL1-01      ggggggccggcttgg-gggccggcagcggcggcgccacccctccgggagg
A0A2I3RTV4_MCL1-03      ggggggccggcttgg-gggccggcagcggcggcgccacccctccgggagg
                                                                          

A0A2I3RA26_BCL2A1-      gcgatcttggct--------------------------------------
A0A2I3RA26_BCL2A1-      gtgaatttggatatatttacaggctggctca-------------------
A0A2I3RA26_BCL2A1-      gtgaatttggatatatttacaggctggctca-------------------
A0A2I3RA26_BCL2A1-      gtgaatttggatatatttacaggctggctca-------------------
H2Q805_BCL2L2-03        ggggctgcgggc--------------------------------------
H2Q805_BCL2L2-04        ggggctgcgggc--------------------------------------
H2Q805_BCL2L2-01        ggctctggtggc--------------------------------------
H2Q805_BCL2L2-02        ggctctggtggc--------------------------------------
H2QEM8_BCL2-01          ggagatgtgggcgccgcgcccccgggggccgcccccg-------------
H2Q9G4_BCL2L10-01       gcggttgctggc-cgactacctggggtactgcgcccg-------------
G2HFR3_MCL1-01          gtgaatttta----------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      gcgacttttggc-tacggagaaggaggcctcggcccggcgagagataggg
A0A2I3RTV4_MCL1-01      gcgacttttggc-tacggagaaggaggcctcggcccggcgagagataggg
A0A2I3RTV4_MCL1-03      gcgactttt-----------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        --------------------------------------------------
H2Q805_BCL2L2-04        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          -----------caccgggcatcttctcctcccagcccgggcacacgcccc
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      ggaggggaggccggcgcggtgattggcggaagcgctggcgcaagcccccc
A0A2I3RTV4_MCL1-01      ggaggggaggccggcgcggtgattggcggaagcgctggcgcaagcccccc
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        --------------------------------------------------
H2Q805_BCL2L2-04        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          atccagccgcatcccgggaccc----------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      gtccaccctcacgccagactcccggagggtcgcgcggccgccgcccattg
A0A2I3RTV4_MCL1-01      gtccaccctcacgccagactcccggagggtcgcgcggccgccgcccattg
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        --------------------------------------------------
H2Q805_BCL2L2-04        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      gcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttc
A0A2I3RTV4_MCL1-01      gcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttc
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        --------------------------------------------------
H2Q805_BCL2L2-04        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      gcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgc
A0A2I3RTV4_MCL1-01      gcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgc
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        --------------------------------------------------
H2Q805_BCL2L2-04        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      cgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagc
A0A2I3RTV4_MCL1-01      cgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagc
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        --------------------------------------------------
H2Q805_BCL2L2-04        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      ctctcgggaagcggccggctgtcctgcctctgctggagttggtcggggaa
A0A2I3RTV4_MCL1-01      ctctcgggaagcggccggctgtcctgcctctgctggagttggtcggggaa
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        --------------------------------------------------
H2Q805_BCL2L2-04        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      tctggtaataacaccagtacggacgggtcactaccctcgacgccgccgcc
A0A2I3RTV4_MCL1-01      tctggtaataacaccagtacggacgggtcactaccctcgacgccgccgcc
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        --------------------------------------------------
H2Q805_BCL2L2-04        --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      agcagaggaggaggaggacgagttgtaccggcagtccctggagattatct
A0A2I3RTV4_MCL1-01      agcagaggaggaggaggacgagttgtaccggcagtccctggagattatct
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      ---------------------------------------------cactg
A0A2I3RA26_BCL2A1-      -------------------ggactatctgcagtacgtcctacagatacca
A0A2I3RA26_BCL2A1-      -------------------ggactatctgcagtacgtcctacagatacca
A0A2I3RA26_BCL2A1-      -------------------ggactatctgcagtacgtcctacagatacca
H2Q805_BCL2L2-03        -------------------ggtc----ggggctccgggccggggcggcgg
H2Q805_BCL2L2-04        -------------------ggtc----ggggctccgggccggggcggcgg
H2Q805_BCL2L2-01        -------------------agactttgtaggttataagctgaggcagaag
H2Q805_BCL2L2-02        -------------------agactttgtaggttataagctgaggcagaag
H2QEM8_BCL2-01          -------------------ggtcgccaggacctcgccgctgcagaccccg
H2Q9G4_BCL2L10-01       -------------------ggaacccggcacccccgagccgacgcc---g
G2HFR3_MCL1-01          ---------------------------------------------cattg
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      ctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatg
A0A2I3RTV4_MCL1-01      ctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatg
A0A2I3RTV4_MCL1-03      -------------------ggccaccggcgccaaggacacaaagccaatg
                                                                          

A0A2I3RA26_BCL2A1-      ca---------gcctcg---------------------------------
A0A2I3RA26_BCL2A1-      ca---------acctggatcaggtccaagcaaaacgtccagagtgctaca
A0A2I3RA26_BCL2A1-      ca---------acctggatcaggtccaagcaaaacgtccagagtgctaca
A0A2I3RA26_BCL2A1-      ca---------acctggatcaggtccaagcaaaacgtccagagtgctaca
H2Q805_BCL2L2-03        cgccatcttgtgcccggggccggt----ggggag-gccggggagggggcc
H2Q805_BCL2L2-04        cgccatcttgtgcccggggccggt----ggggag-gccggggagggggcc
H2Q805_BCL2L2-01        ggtta---tgtctgtggagctggccccggggagg-gcccagcagctgacc
H2Q805_BCL2L2-02        ggtta---tgtctgtggagctggccccggggagg-gcccagcagctgacc
H2QEM8_BCL2-01          gc------tgcccccggcgccgccgcggggcctgcgctcagcccggtgcc
H2Q9G4_BCL2L10-01       tc------cacgcccgaggccgccg---------------------tgct
G2HFR3_MCL1-01          tg------cat-------------------------ctggatatataccc
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      gg------caggtctggggccaccagcaggaaggcgctggagaccttacg
A0A2I3RTV4_MCL1-01      gg------caggtctggggccaccagcaggaaggcgctggagaccttacg
A0A2I3RTV4_MCL1-03      gg------caggtctggggccaccagcaggaaggcgctggagaccttacg
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      aaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagtcat
A0A2I3RA26_BCL2A1-      aaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagtcat
A0A2I3RA26_BCL2A1-      aaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagtcat
H2Q805_BCL2L2-03        ccggggggcgcaggggactacgggaacggcctg----gagtctgag----
H2Q805_BCL2L2-04        ccggggggcgcaggggactacgggaacggcctg----gagtctgag----
H2Q805_BCL2L2-01        c-----gctgcaccaagccatgcgggcagctggagatgagttcgagaccc
H2Q805_BCL2L2-02        c-----gctgcaccaagccatgcgggcagctggagatgagttcgagaccc
H2QEM8_BCL2-01          acctgtggtccacctgaccctccgccaggccggcgacgacttctcccgcc
H2Q9G4_BCL2L10-01       g---------------------cgctccgcggccgccaggttacggcaga
G2HFR3_MCL1-01          a---------------------ccacctgagtgtacca---ttca-----
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      a---------------------cgggttggggatggcg---tgcagcgca
A0A2I3RTV4_MCL1-01      a---------------------cgggttggggatggcg---tgcagcgca
A0A2I3RTV4_MCL1-03      a---------------------cgggttggggatggcg---tgcagcgca
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      gcttg-----------------gacaatgttaatgttgtgtctg------
A0A2I3RA26_BCL2A1-      gcttg-----------------gacaatgttaatgttgtgtctg------
A0A2I3RA26_BCL2A1-      gcttg-----------------gacaatgttaatgttgtgtctg------
H2Q805_BCL2L2-03        --------------------gaactggagcctgaggagctgctgctggag
H2Q805_BCL2L2-04        --------------------gaactggagcctgagga-------------
H2Q805_BCL2L2-01        gcttccggcgcaccttctctgatctggcggctcagctgcatgtg------
H2Q805_BCL2L2-02        gcttccggcgcaccttctctgatctggcggctcagctgcatgtg------
H2QEM8_BCL2-01          gctaccgccgcgacttcgccgagatgtccagccagctgcacctg------
H2Q9G4_BCL2L10-01       tccaccggtccttcttctccg-cctacctcggctacc-------------
G2HFR3_MCL1-01          ----------------------catgtt------actggacatc------
A0A2I3RTV4_MCL1-04      ----------------------catgcttcggaaactggacatc------
A0A2I3RTV4_MCL1-02      accatgagacggccttccaa------------------------------
A0A2I3RTV4_MCL1-01      accatgagacggccttccaaggcatgcttcggaaactggacatc------
A0A2I3RTV4_MCL1-03      accatgagacggccttccaaggcatgcttcggaaactggacatc------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      ---------tagacactgccagaacactattcaaccaagtgatggaaaag
A0A2I3RA26_BCL2A1-      ---------tagacactgccagaacactattcaaccaagtgatggaaaag
A0A2I3RA26_BCL2A1-      ---------tagacactgccagaacactattcaaccaagtgatggaaaag
H2Q805_BCL2L2-03        cccgagccggagcccgagcccgaagaggagccgccccggcccc-------
H2Q805_BCL2L2-04        --------------------------------------------------
H2Q805_BCL2L2-01        -----accccaggctcagcccaacaacgcttcacccaggtctccgatgaa
H2Q805_BCL2L2-02        -----accccaggctcagcccaacaacgcttcacccaggtctccgatgaa
H2QEM8_BCL2-01          -----acgcccttcaccgcgcggggacgctttgccacggtggtggaggag
H2Q9G4_BCL2L10-01       ---------ccgggaaccgcttcgagctggtggcgctgatggcggattcc
G2HFR3_MCL1-01          -----aaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccat
A0A2I3RTV4_MCL1-04      -----aaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccat
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      -----aaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccat
A0A2I3RTV4_MCL1-03      -----aaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccat
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      gagtttgaagatgg---catcattaactggggaagaattgtaaccatatt
A0A2I3RA26_BCL2A1-      gagtttgaagatgg---catcattaactggggaagaattgtaaccatatt
A0A2I3RA26_BCL2A1-      gagtttgaagatgg---catcattaactggggaagaattgtaaccatatt
H2Q805_BCL2L2-03        -----------gcg------cccccccgggagctcc----gggccctggg
H2Q805_BCL2L2-04        --------------------------------------------------
H2Q805_BCL2L2-01        ctttttcaaggggg------ccccaactggggccgccttgtagccttctt
H2Q805_BCL2L2-02        ctttttcaaggggg------ccccaactggggccgccttgtagccttctt
H2QEM8_BCL2-01          ctcttcagggacgg------ggtgaactgggggaggattgtggccttctt
H2Q9G4_BCL2L10-01       gtgctctccgacagccccggccccacctggggcagagtggtgacgctcgt
G2HFR3_MCL1-01          gttttcagcgacgg---cgtaacaaactggggcaggattgtgactctcat
A0A2I3RTV4_MCL1-04      gttttcagcgacgg---cgtaacaaactggggcaggattgtgactctcat
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      gttttcagcgacgg---cgtaacaaactggggcaggattgtgactctcat
A0A2I3RTV4_MCL1-03      gttttcagcgacgg---cgtaacaaactggggcaggattgtgactctcat
                                                                          

A0A2I3RA26_BCL2A1-      ---------------------------acctccac---------------
A0A2I3RA26_BCL2A1-      tgcatttgaaggtattctcatcaagaaacttctacgacagcaaattgccc
A0A2I3RA26_BCL2A1-      tgcatttgaaggtattctcatcaagaaacttctacgacagcaaattgccc
A0A2I3RA26_BCL2A1-      tgcatttgaaggtattctcatcaagaaacttctacgacagcaaattgccc
H2Q805_BCL2L2-03        cctggttcgggagcccccggcagccaagag-------gaggaggaggagc
H2Q805_BCL2L2-04        -----------------------ccaagag-------gaggaggaggagc
H2Q805_BCL2L2-01        tgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaac
H2Q805_BCL2L2-02        tgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaac
H2QEM8_BCL2-01          tgagttcggtg-----------------------------------gggt
H2Q9G4_BCL2L10-01       gaccttcgcagggacgctg------------------ctggagagagggc
G2HFR3_MCL1-01          ttctttt---------------------------------------ggtg
A0A2I3RTV4_MCL1-04      ttctttt---------------------------------------ggtg
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      ttctttt---------------------------------------ggtg
A0A2I3RTV4_MCL1-03      ttctttt---------------------------------------ggtg
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      cggatgtggatacttataaggagatttcatattt----------------
A0A2I3RA26_BCL2A1-      cggatgtggatacttataaggagatttcatattt----------------
A0A2I3RA26_BCL2A1-      cggatgtggatacttataaggagatttcatattt----------------
H2Q805_BCL2L2-03        c------gggac--------tggtcgaggg---------------tgac-
H2Q805_BCL2L2-04        c------gggac--------tggtcgaggg---------------tgac-
H2Q805_BCL2L2-01        cactggtgggacaagtgcaggagtggatgg---------------tggcc
H2Q805_BCL2L2-02        cactggtgggacaagtgcaggagtggatgg---------------tggcc
H2QEM8_BCL2-01          catgtgtg----------tggaga---------------------gcgtc
H2Q9G4_BCL2L10-01       cgctggtgaccacccggtggaagaagtggggcttccagccgcggctaaat
G2HFR3_MCL1-01          cctttgtggctaaacacttgaaga---------------------ccata
A0A2I3RTV4_MCL1-04      cctttgtggctaaacacttgaaga---------------------ccata
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      cctttgtggctaaacacttgaaga---------------------ccata
A0A2I3RTV4_MCL1-03      cctttgtggctaaacacttgaaga---------------------ccata
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------tgttgc------------------------------
A0A2I3RA26_BCL2A1-      --------------tgttgc------------------------------
A0A2I3RA26_BCL2A1-      --------------tgttgc------------------------------
H2Q805_BCL2L2-03        --ccggggga----cggcgc-------------------cattgaggacc
H2Q805_BCL2L2-04        --ccggggga----cggcgc-------------------cattgaggacc
H2Q805_BCL2L2-01        tacctggaga----cgcggctggctgactggatccacagcagtgggggct
H2Q805_BCL2L2-02        tacctggaga----cgcggctggctgactggatccacagcagtgggggct
H2QEM8_BCL2-01          aaccgggaga----tgtcgc-------------------ccctggtggac
H2Q9G4_BCL2L10-01       gagcaggagggcgacgtcgc-------------------ccgggactgcc
G2HFR3_MCL1-01          aaccaagaaagctgcatcga---------------------------acc
A0A2I3RTV4_MCL1-04      aaccaagaaagctgcatcga---------------------------acc
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      aaccaagaaagctgcatcga---------------------------acc
A0A2I3RTV4_MCL1-03      aaccaagaaagctgcatcga---------------------------acc
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        cggagctggaagctatcaaagctcgagtcagggagatgga---ggaagaa
H2Q805_BCL2L2-04        cggagctggaagctatcaaagctcgagtcagggagatgga---ggaagaa
H2Q805_BCL2L2-01        gggcg------gagttcacagctctatacggggacggggccctggaggag
H2Q805_BCL2L2-02        gggagctggaagctatcaaagctcgagtcagggagatgga---ggaagaa
H2QEM8_BCL2-01          aacatc-----gccct---------------------------gtggatg
H2Q9G4_BCL2L10-01       agcgcctggtggcctt---------------------------gctgagc
G2HFR3_MCL1-01          attagcagaaagtatc---------------------------acagacg
A0A2I3RTV4_MCL1-04      attagcagaaagtatc---------------------------acagacg
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      attagcagaaagtatc---------------------------acagacg
A0A2I3RTV4_MCL1-03      attagcagaaagtatc---------------------------acagacg
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --ggagttcataatgaataacacaggagaatggataagacaaaacgga--
A0A2I3RA26_BCL2A1-      --ggagttcataatgaataacacaggagaatggataagacaaaacgga--
A0A2I3RA26_BCL2A1-      --ggagttcataatgaataacacaggagaatggataagacaaaacgga--
H2Q805_BCL2L2-03        gctgagaagctaaaggagcta---cagaacgaggtagagaagcagatgaa
H2Q805_BCL2L2-04        gctgagaagctaaaggagcta---cagaacgaggtagagaagcagatgaa
H2Q805_BCL2L2-01        gcgcggcgtctgcgggag------------------gggaactgggcatc
H2Q805_BCL2L2-02        gctgagaagctaaaggagcta---cagaacgaggtagagaagcagatgaa
H2QEM8_BCL2-01          actgagtacctgaaccggcacctgcacacctggatccaggataacgga--
H2Q9G4_BCL2L10-01       tcgcggctcgtggggcagcac---cgcgcctggctgcaggctcagggc--
G2HFR3_MCL1-01          tt----ctcgtaaggacaaaa---cgggactggctagttaaacaaaga--
A0A2I3RTV4_MCL1-04      tt----ctcgtaaggacaaaa---cgggactggctagttaaacaaaga--
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      tt----ctcgtaaggacaaaa---cgggactggctagttaaacaaaga--
A0A2I3RTV4_MCL1-03      tt----ctcgtaaggacaaaa---cgggactggctagttaaacaaaga--
                                                                          

A0A2I3RA26_BCL2A1-      ----------------ggctcaagaaaatggctttgtaaagaagttt---
A0A2I3RA26_BCL2A1-      ----------------ggctgggggaaatggc---------acaatc---
A0A2I3RA26_BCL2A1-      ----------------ggct-gggaaaatggctttgtaaagaagttt---
A0A2I3RA26_BCL2A1-      ----------------ggct-gggaaaatggctttgtaaagaagttt---
H2Q805_BCL2L2-03        tatgagtccaccaccaggcaatg----ctggcccagtgatcatgtccatt
H2Q805_BCL2L2-04        tatgagtccaccaccaggcaatg----ctggcccagtgatcatgtccatt
H2Q805_BCL2L2-01        agtgag----------gacagtg----ctgac------------------
H2Q805_BCL2L2-02        tatgagtccaccaccaggcaatg----ctggcccagtgatcatgtccatt
H2QEM8_BCL2-01          ----------------ggctggg----atgcctttgtggaactgtac---
H2Q9G4_BCL2L10-01       ----------------ggctggg----atggcttttgtcacttcttc---
G2HFR3_MCL1-01          ----------------ggctggg----atgggtttgtggagttcttccat
A0A2I3RTV4_MCL1-04      ----------------ggctggg----atgggtttgtggagttcttccat
A0A2I3RTV4_MCL1-02      ---------------------gg----atgggtttgtggagttcttccat
A0A2I3RTV4_MCL1-01      ----------------ggctggg----atgggtttgtggagttcttccat
A0A2I3RTV4_MCL1-03      ----------------ggctggg----atgggtttgtggagttcttccat
                                                    **                    

A0A2I3RA26_BCL2A1-      -----gaacataaat-ctggc-------------tggatgacttttctag
A0A2I3RA26_BCL2A1-      -----acacgcctatgctggt-------------agagtcagtggcccac
A0A2I3RA26_BCL2A1-      -----gaacataaat-ctggc-------------tggatgacttttctag
A0A2I3RA26_BCL2A1-      -----gaacataaat-ctggc-------------tggatgacttttctag
H2Q805_BCL2L2-03        gaggagaagatggaggctgatgcccgttccatctatgttggcaat----g
H2Q805_BCL2L2-04        gaggagaagatggaggctgatgcccgttccatctatgttggcaat----g
H2Q805_BCL2L2-01        -----------gggggccg-------------------tggcact----g
H2Q805_BCL2L2-02        gaggagaagatggaggctgatgcccgttccatctatgttggcaat----g
H2QEM8_BCL2-01          -----ggccccagcatgcggcctctgtttgatttctcctggctgtctctg
H2Q9G4_BCL2L10-01       ----aggaccc------------------cctttccgctggct-ttttgg
G2HFR3_MCL1-01          gtagaggacctagaaggtggcatcag-gaatgtgctgctggct-ttt--g
A0A2I3RTV4_MCL1-04      gtagaggacctagaaggtggcatcag-gaatgtgctgctggct-ttt--g
A0A2I3RTV4_MCL1-02      gtagaggacctagaaggtggcatcag-gaatgtgctgctggct-ttt--g
A0A2I3RTV4_MCL1-01      gtagaggacctagaaggtggcatcag-gaatgtgctgctggct-ttt--g
A0A2I3RTV4_MCL1-03      gtagaggacctagaaggtggcatcag-gaatgtgctgctggct-ttt--g
                                                              *           

A0A2I3RA26_BCL2A1-      aagttacaggaaagatctcaatactgttgaccagaaaggacactccatat
A0A2I3RA26_BCL2A1-      aagaagaggaaaatggc---------------------------------
A0A2I3RA26_BCL2A1-      aagttacaggaaagatc---------------------------------
A0A2I3RA26_BCL2A1-      aagttacaggaaagatctcaatactgttgaccagaaaggacactccatat
H2Q805_BCL2L2-03        tggactatggtgcaacagcagaagagctggaagctcactttcatggctgt
H2Q805_BCL2L2-04        tggactatggtgcaacagcagaagagctggaagctcactttcatggctgt
H2Q805_BCL2L2-01        ggggccctggt---------------------------------------
H2Q805_BCL2L2-02        tggactatggtgcaacagcagaagagctggaagctcactttcatggctgt
H2QEM8_BCL2-01          aagactctgctcagtttggc------------------------------
H2Q9G4_BCL2L10-01       agaaaacagctggtccag--------------------------------
G2HFR3_MCL1-01          caggtgttgctggagtagga------------------------------
A0A2I3RTV4_MCL1-04      caggtgttgctggagtagga------------------------------
A0A2I3RTV4_MCL1-02      caggtgttgctggagtagga------------------------------
A0A2I3RTV4_MCL1-01      caggtgttgctggagtagga------------------------------
A0A2I3RTV4_MCL1-03      caggtgttgctggagtagga------------------------------
                                *                                         

A0A2I3RA26_BCL2A1-      tgtgaaaccggccta-----------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      tgtgaaat---gcta-----------------------------------
A0A2I3RA26_BCL2A1-      tgtgaaaccggccta-----------------------------------
H2Q805_BCL2L2-03        ggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcc
H2Q805_BCL2L2-04        ggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcc
H2Q805_BCL2L2-01        ---------------------------------aactgtaggggcctt--
H2Q805_BCL2L2-02        ggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcc
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        caaagggtttgcgtatatagagttctcagacaaagagtcagtgaggactt
H2Q805_BCL2L2-04        caaagggtttgcgtatatagagttctcagacaaagagtcagtgaggactt
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        caaagggtttgcgtatatagagttctcagacaaagagtcagtgaggactt
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        ccttggccttagatgagtccctatttagaggaaggcaaatcaaggtgatc
H2Q805_BCL2L2-04        ccttggccttagatgagtccctatttagaggaaggcaaatcaaggtgatc
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        ccttggccttagatgagtccctatttagaggaaggcaaatcaaggtgatc
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------------------------------------------------
H2Q805_BCL2L2-03        ccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttcc
H2Q805_BCL2L2-04        ccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttcc
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        ccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttcc
H2QEM8_BCL2-01          --------------------------------------------------
H2Q9G4_BCL2L10-01       --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      --------atttttctgactgttatggaaacgattgccaacacatacttc
A0A2I3RA26_BCL2A1-      --------------------------------------------------
A0A2I3RA26_BCL2A1-      --------tctctcct----------gaagcaa-----------------
A0A2I3RA26_BCL2A1-      --------atttttctgactgttatggaaacgattgccaacacatacttc
H2Q805_BCL2L2-03        acgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctc
H2Q805_BCL2L2-04        acgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctc
H2Q805_BCL2L2-01        --------------------------------------------------
H2Q805_BCL2L2-02        acgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctc
H2QEM8_BCL2-01          --------cctggtggga-------gcttgcatcaccctgggtgcctatc
H2Q9G4_BCL2L10-01       --------gcttttctgtcatgcttgttaacaacagccttcatttatctc
G2HFR3_MCL1-01          --------gctggtttggcatatctaataa--------------------
A0A2I3RTV4_MCL1-04      --------gctggtttggcatatctaataa--------------------
A0A2I3RTV4_MCL1-02      --------gctggtttggcatatctaataa--------------------
A0A2I3RTV4_MCL1-01      --------gctggtttggcatatctaataa--------------------
A0A2I3RTV4_MCL1-03      --------gctggtttggcatatctaataa--------------------
                                                                          

A0A2I3RA26_BCL2A1-      tacttt--------------------------------------------
A0A2I3RA26_BCL2A1-      --tttg--------------------------------------------
A0A2I3RA26_BCL2A1-      tactgt--------------------------------------------
A0A2I3RA26_BCL2A1-      tacttt--------------------------------------------
H2Q805_BCL2L2-03        gattctacagtggttttaacagcaggccccggggtcgcgtctacaggggc
H2Q805_BCL2L2-04        gattctacagtggttttaacagcaggccccggggtcgcgtctacaggggc
H2Q805_BCL2L2-01        -------------ttttgctagcaag------------------------
H2Q805_BCL2L2-02        gattctacagtggttttaacagcaggccccggggtcgcgtctacaggggc
H2QEM8_BCL2-01          tgggccacaa-------g--------------------------------
H2Q9G4_BCL2L10-01       tgg---acacgattatta--------------------------------
G2HFR3_MCL1-01          --g---atag----------------------------------------
A0A2I3RTV4_MCL1-04      --g---atag----------------------------------------
A0A2I3RTV4_MCL1-02      --g---atagccttactg--------------------------------
A0A2I3RTV4_MCL1-01      --g---atag----------------------------------------
A0A2I3RTV4_MCL1-03      --g---atag----------------------------------------
                                                                          

A0A2I3RA26_BCL2A1-      ---------------------------------taa
A0A2I3RA26_BCL2A1-      ---------------------------------taa
A0A2I3RA26_BCL2A1-      ---------------------------------tga
A0A2I3RA26_BCL2A1-      ---------------------------------taa
H2Q805_BCL2L2-03        cgggctagagcgacatcatggtattccccttactaa
H2Q805_BCL2L2-04        cgggctagagcgacatcatggtattccccttactaa
H2Q805_BCL2L2-01        ---------------------------------tga
H2Q805_BCL2L2-02        cgggctagagcgacatcatggtattccccttactaa
H2QEM8_BCL2-01          ---------------------------------tga
H2Q9G4_BCL2L10-01       ---------------------------------tga
G2HFR3_MCL1-01          ------------------------------------
A0A2I3RTV4_MCL1-04      ------------------------------------
A0A2I3RTV4_MCL1-02      ---------------------------------taa
A0A2I3RTV4_MCL1-01      ------------------------------------
A0A2I3RTV4_MCL1-03      ------------------------------------
                                                            

© 1998-2022Legal notice