Dataset for CDS MCL-1 of organism Oncorhynchus kisutch

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C7H1W6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=867 residues).
atgagtctgttgtcgtcgtcgattgcccgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagc
tgatgatgctagccctttgtactatatcgacggggccgtatgtgctggggcgtcaccgaagtctaaagtggacttgggaa
atgggaccggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacgtcctcgataatcatttg
tcagaccgaagcaacaatgacgattctttgccctgcactcctcagatggcgtcagaatgtgggcctgaactattggaaca
tgataccagacaactcattgatgatatgttgagggaatacacaggactgtctcagcctcgatggaagcaaagcaagtatc
ttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatgcatacaatggtatggtcgtcaaacttgac
ttggatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccatgttcagtgatgggatcacgaactgggg
tcgcatcgccagcctggtggcatttggcgcagtggtgagccagcacctgaaggagagtggcaggggacactgcgttgatt
tggtgggccgagagattgccacatacctcctctctgaccaaagggactggctggtcaaaaacaatgcttggaatggattt
gtagagttttttcatgttcaagatcctgagtcctcggtaaggaacaccctcctagcctttgctggagttgctgggattgg
ggcaacacttgccatgttgatcagaaagtgccctgctctaccccaggggtgtgtggtgtgtttgtga
>gnl|bcl2dbcds|A0A8C7H1W6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=825 residues).
atgagtctgttgtcgtcgtcgattgcccgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagc
tgatgatgctagccctttgtactatatcgacggggccgtatgtgctggggcgtcaccgaagtctaaagtggacttgggaa
atgggaccggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacgtcctcgataatcatttg
tcagaccgaagcaacaatgacgattctttgccctgcactcctcagatggcgtcagaatgtgggcctgaactattggaaca
tgataccagacaactcattgatgatatgttgagggaatacacaggactgtctcagcctcgatggaagcaaagcaagtatc
ttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatgcatacaatggtatggtcgtcaaacttgac
ttggatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccatgttcagtgatgggatcacgaactgggg
tcgcatcgccagcctggtggcatttggcgcagtggtgagccagcacctgaaggagagtggcaggggacactgcgttgatt
tggtgggccgagagattgccacatacctcctctctgaccaaagggactggctggtcaaaaacaatgcttggaatggattt
gtagagttttttcatgttcaagatcctgagtcctcgaaaatggactatgcccgcaagttctctgaaatccttgatagcac
catggttggaatgagtacccagtga
>gnl|bcl2dbcds|A0A8C7H400_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=909 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacccctttgtgctatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatataatagca
aagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcatcaattc
tgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcagtggtga
gccagcacttgaaggagattggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctctctgac
caaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagt
aaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcagacagtgccctgctc
taccccaggggtgtgtggtgtgtttgtga
>gnl|bcl2dbcds|A0A8C7H400_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=882 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacccctttgtgctatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatataatagca
aagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcatcaattc
tgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcagtggtga
gccagcacttgaaggagattggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctctctgac
caaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagt
aaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcaggaattcagcagatt
ag
>gnl|bcl2dbcds|A0A8C7N2B4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=963 residues).
atggcatgtcctgacattggtaaccgcgtcaaggcaacgttgaagcatctgaaagtggcagggtctatcgacagcactcc
tttgttcactagcagaggacctgaacatgagtacagatggggagacctcgaaacggatagctccttagcttacggcagca
aacactttggtgtactaggagagtctgccaacatgtaccaccttccaaatacggttgacacacacaaatgtttcatgtgt
aacctcgaaatcaagaactttgttgagaacgacaccctgctaggtgagcacatctttcacgtgtacaacacaagcggacg
ctgtaagtaccttaccgataggtacacgaatcgagaagacgagatgatgctcttactggggaaggaacggtacaggaggg
gaaaaattgcattccctgatagcatcatcaccaactcgaccggagccctggacaccgacaccaggcaactcattaaatgt
gtcctaggacaatgtacgggacttctgaaacctaggtggaacgaaagcaaagctctgtcaacaatgagtagagttatcgg
gcagttactagagaagcacagatacacatacaacggtatgatcaacacactctatgtggatgacagaggggataacgtga
agttcctcagtgcagtagcccatagcatctttgaagacgggaccgtcaactggggccgtgttgccagcctgacatctttt
ggggctgcggtgtgccggtacttgagaggcaaggggagagacaactgtgtggatttggtgggagaggagatatcagagta
cctggtcactcaccacaaggactggctagtcaaacataactcctggaatgggttcgtggagttctttccagtagcagaac
ctgagtccagatgtcggaacatcatcatgaccatttttggattggctggtattggggcaacaatgaccttcttggttatg
tga
© 1998-2022Legal notice