Dataset for CDS MCL-1 of organism Oncorhynchus kisutch

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C7N2B4_MCL1-01      atggcatgtc-----ctgacattggtaac-cgcgtcaaggcaacgttgaa
A0A8C7H400_MCL1-01      atga---gtc---tgtcgaagtcgattacacgagccacaactacgatgtt
A0A8C7H400_MCL1-02      atga---gtc---tgtcgaagtcgattacacgagccacaactacgatgtt
A0A8C7H1W6_MCL1-01      atga---gtctgttgtcgtcgtcgattgcccgagccacaactacgatgtt
A0A8C7H1W6_MCL1-02      atga---gtctgttgtcgtcgtcgattgcccgagccacaactacgatgtt
                        ***    ***       *   * * *  * ** * **   * *** **  

A0A8C7N2B4_MCL1-01      gcatctgaaagt---------ggcagggtctatcg-------------ac
A0A8C7H400_MCL1-01      gaattttcaaaatggagtcgttggaggctct-tcgtaccctgctgg----
A0A8C7H400_MCL1-02      gaattttcaaaatggagtcgttggaggctct-tcgtaccctgctgg----
A0A8C7H1W6_MCL1-01      gcattttcaaaa---------tggaggatct-tcgtacctagctgatgat
A0A8C7H1W6_MCL1-02      gcattttcaaaa---------tggaggatct-tcgtacctagctgatgat
                        * ** *  **            * *** *** ***               

A0A8C7N2B4_MCL1-01      agcactcctttgttcactagcaga------ggacctgaacatgagtacag
A0A8C7H400_MCL1-01      --tacccctttgtgctatttcggcgagactggggctgtacgt-------g
A0A8C7H400_MCL1-02      --tacccctttgtgctatttcggcgagactggggctgtacgt-------g
A0A8C7H1W6_MCL1-01      gctagccctttgtactatatcgac------ggggccgtatgt-------g
A0A8C7H1W6_MCL1-02      gctagccctttgtactatatcgac------ggggccgtatgt-------g
                           *  ******* *  *  *         **  * * *  *       *

A0A8C7N2B4_MCL1-01      atggggagacctcgaaacggatagctccttagcttacggcagcaaacact
A0A8C7H400_MCL1-01      ctggggcgtcaccga---------------agtcaaaagtggatactgac
A0A8C7H400_MCL1-02      ctggggcgtcaccga---------------agtcaaaagtggatactgac
A0A8C7H1W6_MCL1-01      ctggggcgtcaccga---------------agtctaaagtg------gac
A0A8C7H1W6_MCL1-02      ctggggcgtcaccga---------------agtctaaagtg------gac
                         ***** * *  ***               **   *  *           

A0A8C7N2B4_MCL1-01      ttggtgtactaggagagtctgccaaca-tgtaccaccttccaaatacggt
A0A8C7H400_MCL1-01      ttgg-gtaatggga----ctggcgacactccaccac--------------
A0A8C7H400_MCL1-02      ttgg-gtaatggga----ctggcgacactccaccac--------------
A0A8C7H1W6_MCL1-01      ttgg-gaaatggga----ccggcgatactccaccac--------------
A0A8C7H1W6_MCL1-02      ttgg-gaaatggga----ccggcgatactccaccac--------------
                        **** * * * ***    * * * * * *  *****              

A0A8C7N2B4_MCL1-01      tgacacacacaaatgtttcatgtgtaacctcgaaatcaagaactttgttg
A0A8C7H400_MCL1-01      -gacccacg----------------aagttaggagtgaa------tgtcg
A0A8C7H400_MCL1-02      -gacccacg----------------aagttaggagtgaa------tgtcg
A0A8C7H1W6_MCL1-01      -gacccacg----------------acgttaggagtgaa------tgtcg
A0A8C7H1W6_MCL1-02      -gacccacg----------------acgttaggagtgaa------tgtcg
                         *** ***                 *   * * * * **      *** *

A0A8C7N2B4_MCL1-01      agaacgacaccctgctaggtgagcacatctttcacgtgtacaacacaagc
A0A8C7H400_MCL1-01      tgaaaagcaacgtcctgggtaatcatttgtcagaccgaagcaaca-atga
A0A8C7H400_MCL1-02      tgaaaagcaacgtcctgggtaatcatttgtcagaccgaagcaaca-atga
A0A8C7H1W6_MCL1-01      tgaaaagcaacgtcctcgataatcatttgtcagaccgaagcaaca-atga
A0A8C7H1W6_MCL1-02      tgaaaagcaacgtcctcgataatcatttgtcagaccgaagcaaca-atga
                         ***   ** * * ** * * * **  * *   **     ***** * * 

A0A8C7N2B4_MCL1-01      ggacgctgtaagtaccttaccgataggtacacgaatcgagaagacgagat
A0A8C7H400_MCL1-01      cgactctgacggttctttgcc-----------------------------
A0A8C7H400_MCL1-02      cgactctgacggttctttgcc-----------------------------
A0A8C7H1W6_MCL1-01      cga---------ttctttgcc-----------------------------
A0A8C7H1W6_MCL1-02      cga---------ttctttgcc-----------------------------
                         **         * * ** **                             

A0A8C7N2B4_MCL1-01      gatgctcttactggggaaggaacggtacaggaggggaaaaattgcattcc
A0A8C7H400_MCL1-01      -----------------------------------------ctgcactcc
A0A8C7H400_MCL1-02      -----------------------------------------ctgcactcc
A0A8C7H1W6_MCL1-01      -----------------------------------------ctgcactcc
A0A8C7H1W6_MCL1-02      -----------------------------------------ctgcactcc
                                                                  **** ***

A0A8C7N2B4_MCL1-01      -ctgatagcatcatcaccaactcgaccggagc------------------
A0A8C7H400_MCL1-01      tcagatggcgtcagaat---gtgggcctgaactatcgaattgtcaatcgg
A0A8C7H400_MCL1-02      tcagatggcgtcagaat---gtgggcctgaactatcgaattgtcaatcgg
A0A8C7H1W6_MCL1-01      tcagatggcgtcagaat---gtgggcctgaac------------------
A0A8C7H1W6_MCL1-02      tcagatggcgtcagaat---gtgggcctgaac------------------
                         * *** ** ***  *     * * ** ** *                  

A0A8C7N2B4_MCL1-01      ----------cctggacaccgacaccaggcaactcattaaatgtgtccta
A0A8C7H400_MCL1-01      gcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattg
A0A8C7H400_MCL1-02      gcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattg
A0A8C7H1W6_MCL1-01      ---------tattggaacatgataccagacaactcattgatgatatgttg
A0A8C7H1W6_MCL1-02      ---------tattggaacatgataccagacaactcattgatgatatgttg
                                    ****    ** ** ** ***** *** *     *  * 

A0A8C7N2B4_MCL1-01      ggacaatgtacgggacttctgaaacctaggtggaacgaaagcaaagctct
A0A8C7H400_MCL1-01      gtggactatacaggactgt------ctcgttgtaagcaaagcaaggctct
A0A8C7H400_MCL1-02      gtggactatacaggactgt------ctcgttgtaagcaaagcaaggctct
A0A8C7H1W6_MCL1-01      agggaatacacaggactgtctcagcctcgatggaagcaaagcaagtatct
A0A8C7H1W6_MCL1-02      agggaatacacaggactgtctcagcctcgatggaagcaaagcaagtatct
                            * *  ** *****        ** * ** **  *******   ***

A0A8C7N2B4_MCL1-01      gtcaacaatgagtagagttatcgggcagttactagagaagcacagataca
A0A8C7H400_MCL1-01      tacgacgatgaagcgagtggtgaaggatataatagcaaagcaccgatacg
A0A8C7H400_MCL1-02      tacgacgatgaagcgagtggtgaaggatataatagcaaagcaccgatacg
A0A8C7H1W6_MCL1-01      tacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatg
A0A8C7H1W6_MCL1-02      tacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatg
                          * ** ****   ****  *   * *  ** ***  ****** ****  

A0A8C7N2B4_MCL1-01      catacaacggtatgatcaacacactctatgtggatgacagaggggataac
A0A8C7H400_MCL1-01      catacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgac
A0A8C7H400_MCL1-02      catacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgac
A0A8C7H1W6_MCL1-01      catacaatggtatggtcgtcaaacttgacttggatgatcgatgcgatgac
A0A8C7H1W6_MCL1-02      catacaatggtatggtcgtcaaacttgacttggatgatcgatgcgatgac
                        ******* ****** **  ** ***  *  * *****  ** * *** **

A0A8C7N2B4_MCL1-01      gtgaagttcctcagtgcagtagcccatagcatctttgaagacgggaccgt
A0A8C7H400_MCL1-01      atgagtttcatcaattctgtggccaagaccctgttcagtgatgggaccac
A0A8C7H400_MCL1-02      atgagtttcatcaattctgtggccaagaccctgttcagtgatgggaccac
A0A8C7H1W6_MCL1-01      atgagcgtcgtcaattctgtggccaagaccatgttcagtgatgggatcac
A0A8C7H1W6_MCL1-02      atgagcgtcgtcaattctgtggccaagaccatgttcagtgatgggatcac
                         ***   ** *** * * ** *** * * * * **    ** **** *  

A0A8C7N2B4_MCL1-01      caactggggccgtgttgccagcctgacatcttttggggctgcggtgtgcc
A0A8C7H400_MCL1-01      gaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagcc
A0A8C7H400_MCL1-02      gaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagcc
A0A8C7H1W6_MCL1-01      gaactggggtcgcatcgccagcctggtggcatttggcgcagtggtgagcc
A0A8C7H1W6_MCL1-02      gaactggggtcgcatcgccagcctggtggcatttggcgcagtggtgagcc
                         ******** **  * *********    * ***** ** * **** ***

A0A8C7N2B4_MCL1-01      ggtacttgagaggcaaggggagagacaactgtgtggatttggtgggagag
A0A8C7H400_MCL1-01      agcacttgaaggagattggcaggggacactgcattgagtcggtgggccaa
A0A8C7H400_MCL1-02      agcacttgaaggagattggcaggggacactgcattgagtcggtgggccaa
A0A8C7H1W6_MCL1-01      agcacctgaaggagagtggcaggggacactgcgttgatttggtgggccga
A0A8C7H1W6_MCL1-02      agcacctgaaggagagtggcaggggacactgcgttgatttggtgggccga
                         * ** ***  *  *  ** ** *   ****  * ** * ******    

A0A8C7N2B4_MCL1-01      gagatatcagagtacctggtcactcaccacaaggactggctagtcaaaca
A0A8C7H400_MCL1-01      aagatcgccacatacctcctctctgaccaaagggactggctggtcaaaaa
A0A8C7H400_MCL1-02      aagatcgccacatacctcctctctgaccaaagggactggctggtcaaaaa
A0A8C7H1W6_MCL1-01      gagattgccacatacctcctctctgaccaaagggactggctggtcaaaaa
A0A8C7H1W6_MCL1-02      gagattgccacatacctcctctctgaccaaagggactggctggtcaaaaa
                         ****  *    *****  ** ** **** * ********* ****** *

A0A8C7N2B4_MCL1-01      taactcctggaatgggttcgtggagttctttccagtagcagaacctgagt
A0A8C7H400_MCL1-01      caatgcttggaatggatttgtagagttctttcatgtgcaagatccagagt
A0A8C7H400_MCL1-02      caatgcttggaatggatttgtagagttctttcatgtgcaagatccagagt
A0A8C7H1W6_MCL1-01      caatgcttggaatggatttgtagagttttttcatgttcaagatcctgagt
A0A8C7H1W6_MCL1-02      caatgcttggaatggatttgtagagttttttcatgttcaagatcctgagt
                         **  * ******** ** ** ***** ****  **   *** ** ****

A0A8C7N2B4_MCL1-01      ccagatgtcggaacatcatcatgaccatttttggattggctggtattggg
A0A8C7H400_MCL1-01      cctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggg
A0A8C7H400_MCL1-02      cctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggg
A0A8C7H1W6_MCL1-01      cctcggtaaggaacaccctcctagcctttgctggagttgctgggattggg
A0A8C7H1W6_MCL1-02      cctcgaaaatggactatgcccgcaagttctctgaaatccttgata-----
                        **        * **     *       *   ** * *   **        

A0A8C7N2B4_MCL1-01      gcaacaatgaccttcttggtta----------------------------
A0A8C7H400_MCL1-01      gcaactctcgccatgttgatcagacagtgccctgctctaccccaggggtg
A0A8C7H400_MCL1-02      gcaactctcgccatgttgatca------------------------ggaa
A0A8C7H1W6_MCL1-01      gcaacacttgccatgttgatcagaaagtgccctgctctaccccaggggtg
A0A8C7H1W6_MCL1-02      gcacca----------tggttggaatgag--------taccca-------
                        *** *           ** *                              

A0A8C7N2B4_MCL1-01      -----------tgtga
A0A8C7H400_MCL1-01      tgtggtgtgtttgtga
A0A8C7H400_MCL1-02      ttcagcagattag---
A0A8C7H1W6_MCL1-01      tgtggtgtgtttgtga
A0A8C7H1W6_MCL1-02      ------------gtga

© 1998-2023Legal notice