Dataset for CDS MCL-1 of organism Bos mutus grunniens

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9W7D1_MCL1-03      atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgg
A0A8B9W7D1_MCL1-04      atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgg
A0A8B9W7D1_MCL1-01      atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgg
A0A8B9W7D1_MCL1-02      atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgg
                        **************************************************

A0A8B9W7D1_MCL1-03      gggagccggattaggacagggcagcggcgcctcctctccgggggggcggc
A0A8B9W7D1_MCL1-04      gggagccggattaggacagggcagcggcgcctcctctccgggggggcggc
A0A8B9W7D1_MCL1-01      gggagccggattaggacagggcagcggcgcctcctctccgggggggcggc
A0A8B9W7D1_MCL1-02      gggagccggattaggacagggcagcggcgcctcctctccgggggggcggc
                        **************************************************

A0A8B9W7D1_MCL1-03      ttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggg
A0A8B9W7D1_MCL1-04      tttt----------------------------------------------
A0A8B9W7D1_MCL1-01      ttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggg
A0A8B9W7D1_MCL1-02      ttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggg
                        ****                                              

A0A8B9W7D1_MCL1-03      gaagccggcacggtgattggcggaagcgccggcccgagccccccggccac
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      gaagccggcacggtgattggcggaagcgccggcccgagccccccggccac
A0A8B9W7D1_MCL1-02      gaagccggcacggtgattggcggaagcgccggcccgagccccccggccac
                                                                          

A0A8B9W7D1_MCL1-03      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
A0A8B9W7D1_MCL1-02      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
                                                                          

A0A8B9W7D1_MCL1-03      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
A0A8B9W7D1_MCL1-02      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
                                                                          

A0A8B9W7D1_MCL1-03      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
A0A8B9W7D1_MCL1-02      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
                                                                          

A0A8B9W7D1_MCL1-03      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
A0A8B9W7D1_MCL1-02      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
                                                                          

A0A8B9W7D1_MCL1-03      ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagt
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagt
A0A8B9W7D1_MCL1-02      ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagt
                                                                          

A0A8B9W7D1_MCL1-03      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccagc
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccagc
A0A8B9W7D1_MCL1-02      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccagc
                                                                          

A0A8B9W7D1_MCL1-03      agaggaggaggaggacgagttatatcggcagtccctggagataatctctc
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      agaggaggaggaggacgagttatatcggcagtccctggagataatctctc
A0A8B9W7D1_MCL1-02      agaggaggaggaggacgagttatatcggcagtccctggagataatctctc
                                                                          

A0A8B9W7D1_MCL1-03      agtacctccgggagcaggcaaccggcgccaaggacgcgaagcccctgggc
A0A8B9W7D1_MCL1-04      ----------------ggcaaccggcgccaaggacgcgaagcccctgggc
A0A8B9W7D1_MCL1-01      agtacctccgggagcaggcaaccggcgccaaggacgcgaagcccctgggc
A0A8B9W7D1_MCL1-02      agtacctccgggagcaggcaaccggcgccaaggacgcgaagcccctgggc
                                        **********************************

A0A8B9W7D1_MCL1-03      gggtctgggaccacaagccggaaggcgttggagaccctgcgccgagtcgg
A0A8B9W7D1_MCL1-04      gggtctgggaccacaagccggaaggcgttggagaccctgcgccgagtcgg
A0A8B9W7D1_MCL1-01      gggtctgggaccacaagccggaaggcgttggagaccctgcgccgagtcgg
A0A8B9W7D1_MCL1-02      gggtctgggaccacaagccggaaggcgttggagaccctgcgccgagtcgg
                        **************************************************

A0A8B9W7D1_MCL1-03      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A8B9W7D1_MCL1-04      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A8B9W7D1_MCL1-01      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A8B9W7D1_MCL1-02      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
                        **************************************************

A0A8B9W7D1_MCL1-03      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A8B9W7D1_MCL1-04      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A8B9W7D1_MCL1-01      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A8B9W7D1_MCL1-02      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
                        **************************************************

A0A8B9W7D1_MCL1-03      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A8B9W7D1_MCL1-04      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A8B9W7D1_MCL1-01      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A8B9W7D1_MCL1-02      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
                        **************************************************

A0A8B9W7D1_MCL1-03      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
A0A8B9W7D1_MCL1-04      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
A0A8B9W7D1_MCL1-01      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
A0A8B9W7D1_MCL1-02      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
                        **************************************************

A0A8B9W7D1_MCL1-03      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A8B9W7D1_MCL1-04      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A8B9W7D1_MCL1-01      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A8B9W7D1_MCL1-02      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
                        **************************************************

A0A8B9W7D1_MCL1-03      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
A0A8B9W7D1_MCL1-04      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
A0A8B9W7D1_MCL1-01      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
A0A8B9W7D1_MCL1-02      tcaaaacgagactggatagtcaaacaaagaggctggg-taagtttgt---
                        ************************************* *  ******   

A0A8B9W7D1_MCL1-03      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A8B9W7D1_MCL1-04      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A8B9W7D1_MCL1-01      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9W7D1_MCL1-03      cttttgcaggtgttgccggagtaggagctggtttggcatatctaataaga
A0A8B9W7D1_MCL1-04      cttttgcaggtgttgccggagtaggagctggtttggcatatctaataaga
A0A8B9W7D1_MCL1-01      cttttgcagtcgatactagattgtatacagaaccagctgatgtaatggta
A0A8B9W7D1_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9W7D1_MCL1-03      ------------tag
A0A8B9W7D1_MCL1-04      ------------tag
A0A8B9W7D1_MCL1-01      tgcaacctggtgtag
A0A8B9W7D1_MCL1-02      ----------tttaa
                                    ** 

© 1998-2022Legal notice