Dataset for CDS BCL-2-like of organism Mola mola

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3WIW8_BCL2L1-      at----------------------gtc-tgt--aaacag-----------
A0A3Q3X5M5_BCL2L1-      at----------------------gtcgcacagtaacag-----------
A0A3Q3VI28_BCL2L10      at----------------------gtcgtgc--gggctg-----------
A0A3Q3VP02_MCL1-01      atgaacgtgttgtttcaaaatggagtcgtgtcgggaccgacgcgttcctc
                        **                      ***         * *           

A0A3Q3WIW8_BCL2L1-      --agaactggtggcttactacata----------aactataaactctccc
A0A3Q3X5M5_BCL2L1-      --agagctggtggagttctttata----------agctacaaactgactc
A0A3Q3VI28_BCL2L10      ------tggaaagagaccctggct---ctcgcacag-gactacctgtcct
A0A3Q3VP02_MCL1-01      gcaaatcgggatgggctcctgtctagactctcacaacggtaatgtcgctt
                                *   *    *                *      *  *  *  

A0A3Q3WIW8_BCL2L1-      atagaggctgtcctctcaaccaca-----tgggactcatagagcctccca
A0A3Q3X5M5_BCL2L1-      aaaa--ga--actacccaacctct----------ctgttaaggcca--ga
A0A3Q3VI28_BCL2L10      tgtgctgc--acaagccagcggcc----------------agcccctcca
A0A3Q3VP02_MCL1-01      taaacgat--acctccaaacggcctaatttactagtagtgaacccaacga
                                   *     * *  *                    **    *

A0A3Q3WIW8_BCL2L1-      acaggactgagggggggc----------aggcagtgtcag----------
A0A3Q3X5M5_BCL2L1-      agataccggtgggagga----ctgaaggagacaaggccag----------
A0A3Q3VI28_BCL2L10      ------------------cctcccagcgagtcagc---------------
A0A3Q3VP02_MCL1-01      aggaatatatgggaaaacccatccgaaaagacagcaccgacaccgacgac
                                                    ** **                 

A0A3Q3WIW8_BCL2L1-      ------------------atgaggaacagcgggtagcgacaca-------
A0A3Q3X5M5_BCL2L1-      -------ctctgc------tgccagaaa-tggcttgctggtca-------
A0A3Q3VI28_BCL2L10      -------cgctgc----catgagggacc-tggct--caggaca-------
A0A3Q3VP02_MCL1-01      gacggttcgctgccgtacacgccggata-tgtcc--ccggacagtgaact
                                            *    *    *     *    **       

A0A3Q3WIW8_BCL2L1-      ----------------------------cgccaatgggacttttaacggt
A0A3Q3X5M5_BCL2L1-      ------------------------------acagcagtagtag-------
A0A3Q3VI28_BCL2L10      -----------------------------------tggagaagcaacacc
A0A3Q3VP02_MCL1-01      caacgtctccggttgtttggcgggggatgaactgttggagaag-gacacg
                                                            * *           

A0A3Q3WIW8_BCL2L1-      acgagtcccgggacccctccaagg--------tccccgctgcggctgcaa
A0A3Q3X5M5_BCL2L1-      gggtggactgtctccttccacagg---------tgctgacatggaggctg
A0A3Q3VI28_BCL2L10      ag---gctcgcttccactccctggctcagaccttcttga---ggcagtgc
A0A3Q3VP02_MCL1-01      aggcagctcattagccgcgtcttgatggaactttctggacacggaagagc
                                      *        *             *    **  *   

A0A3Q3WIW8_BCL2L1-      ccgtcgacaacaagtctggacgcagtaaaagatgccctgcgggactctgc
A0A3Q3X5M5_BCL2L1-      ttaa--------------------gtcgg-----cgcttagggactcagc
A0A3Q3VI28_BCL2L10      gggacggacc----------catgctcca-----gcctcaggaacgtgat
A0A3Q3VP02_MCL1-01      acgatggactgaaagcagaacactatcaa-----cgatgaaaagagtcgt
                                                 *           *            

A0A3Q3WIW8_BCL2L1-      caacgagttcgagctgcggtatgcccgcgccttcagtgacctgcacaacc
A0A3Q3X5M5_BCL2L1-      caatgagtttgagcagctcttcacacaagcgttcagtgacctctcctcgc
A0A3Q3VI28_BCL2L10      ggaggagctggtgggag---acggacacttgaactgggg---------ga
A0A3Q3VP02_MCL1-01      ggccgagcttttggaaaaacacagatacgtatacaatggtat-gacaaaa
                            *** *   *                    *   *            

A0A3Q3WIW8_BCL2L1-      agctccacatcacaccggccaccgc-ctaccaaagctttgagaacgtgat
A0A3Q3X5M5_BCL2L1-      agcttgacatcacccctgacacagc-ctatcacagttttaagagcgtgat
A0A3Q3VI28_BCL2L10      gggttgtttc----------------cattttcacctttactggggtgct
A0A3Q3VP02_MCL1-01      agactgtcattggctgacacacaggacaatgtgagttttgtcagcactgt
                         *                        *      *  ***          *

A0A3Q3WIW8_BCL2L1-      ggacgagg---tgttca--gggacggtgtc---aactggggacgcatagt
A0A3Q3X5M5_BCL2L1-      ggacgagg---tgttca--aggacggggtc---aactggggacgtatagt
A0A3Q3VI28_BCL2L10      ggccagacaactgctcgaacaga-agagcacaaagccggggctggaaccc
A0A3Q3VP02_MCL1-01      atccagagatctgtttt--cagatggagcaacgaactggggccgtattgc
                           *       ** *      **  * *     * * ****  * *    

A0A3Q3WIW8_BCL2L1-      cggactcttcgctttcggc-----ggtgcactg-tgcgtagagtgcgttg
A0A3Q3X5M5_BCL2L1-      gggactgtttgcctttgga-----ggtgttcta-tgtgtggaatgtgctg
A0A3Q3VI28_BCL2L10      aggcaggaccaggaccaggaactggg---acaagtgcctg----------
A0A3Q3VP02_MCL1-01      cagcctggttgcctttggggtcgtggtgtcccagtgcctgaag------g
                          *              *      **    *   **  *           

A0A3Q3WIW8_BCL2L1-      agaaggagatgagtccactggtgggcaggatcatcgagtggatgacggtc
A0A3Q3X5M5_BCL2L1-      agaaggatacaggtgagcttgtttgccgcattgcagactggatgaccact
A0A3Q3VI28_BCL2L10      ------------gtaattgcagtgaactggc------cgagaccatagca
A0A3Q3VP02_MCL1-01      agaacggcaagagtgaccgtgtggagctggtggctcatgagatctccaca
                                    **                          **        

A0A3Q3WIW8_BCL2L1-      tat---ctggacaaccaaatccagccctggatcgagagccagggaggatg
A0A3Q3X5M5_BCL2L1-      tac---ctggatgagcatattaatccgtggatccagagtcaaggtggatg
A0A3Q3VI28_BCL2L10      gactacctgggagaggagaagaaagcctggctcctggagaacgacggatg
A0A3Q3VP02_MCL1-01      tacctgttgacagaccagcggga----------ctggatgtgtgtgggcg
                         *     **    *  *     *            *         **  *

A0A3Q3WIW8_BCL2L1-      gcaac-gctttgccgaaatcttcggacaggacgcggctgctg----agag
A0A3Q3X5M5_BCL2L1-      gggct-gctttgctgaggtttttgggcacaacgccgctgcagaagcaa--
A0A3Q3VI28_BCL2L10      ggaggggttctgt-aagttctct------cactctgccagagaggcaagg
A0A3Q3VP02_MCL1-01      gtgatggctttgtcgagttcttt------c---------gagtagcagac
                        *     * * **   *  * *                    *    *   

A0A3Q3WIW8_BCL2L1-      caggaggtctcaggagagcttcaagaagtggctgctggccgggatgaccc
A0A3Q3X5M5_BCL2L1-      --ggagatctcaggagactctgaatagatggctcctagtcggggtggcgc
A0A3Q3VI28_BCL2L10      ctggactcatcgatgaagacggccttgtttgctgctgctggtgtgggtct
A0A3Q3VP02_MCL1-01      ccagaatccacggtgaggaacgcgctcatgaccattgctggagttgctgg
                           **     *                 *  *   *    * *  *    

A0A3Q3WIW8_BCL2L1-      tggtgaccggagtcgtggttggctcgctcattgtccagaaacgcctgtga
A0A3Q3X5M5_BCL2L1-      tgctaatgggagttatggtcggtgtgttcattgctaagaaaca---gtaa
A0A3Q3VI28_BCL2L10      cgcc----ggtctcacctt---cctgct---------ggtgcg---ctag
A0A3Q3VP02_MCL1-01      tatt----ggggcgacactggccctgtt---------gatcag---gtga
                                **        *      * *         *         *  

© 1998-2020Legal notice