Dataset for CDS MCL-1 of organism Coturnix japonica

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C2TT61_MCL1-01      atgtttgccgtcaaacggaacgccgtcatcggcttcaatctctattgcgg
A0A8C2TT61_MCL1-02      atgtttgccgtcaaacggaacgccgtcatcggcttcaatctctattgcgg

A0A8C2TT61_MCL1-01      cggaggaggcccgggcctggtgcccgcttcaccggcaggagaccaacccg
A0A8C2TT61_MCL1-02      cggaggaggcccgggcctggtgcccgcttcaccggcaggagaccaacccg

A0A8C2TT61_MCL1-01      cgccacccgccgccgccgccgctccggccgccgccaccggctctgaggta
A0A8C2TT61_MCL1-02      cgccacccgccgccgccgccgctccggccgccgccaccggctctgaggta

A0A8C2TT61_MCL1-01      ccgcggcctctgattggctcagcggggctgtgggcctccaccggcctcgc
A0A8C2TT61_MCL1-02      ccgcggcctctgattggctcagcggggctgtgggcctccaccggcctcgc

A0A8C2TT61_MCL1-01      cgaagccccccgcgatcctattggctccggggctgccccccactctccga
A0A8C2TT61_MCL1-02      cgaagccccccgcgatcctattggctccggggctgccccccactctccga

A0A8C2TT61_MCL1-01      ttggctccggggctgccccccactctccgattggttccgagtttgccccc
A0A8C2TT61_MCL1-02      ttggctccggggctgccccccactctccgattggttccgagtttgccccc

A0A8C2TT61_MCL1-01      cactctctgattggtcccgccacggcccgccgggctccgtcggactccac
A0A8C2TT61_MCL1-02      cactctctgattggtcccgccacggcccgccgggctccgtcggactccac

A0A8C2TT61_MCL1-01      accgaggcccgtcgctctgtggagccccgaggaggagttggacggatacg
A0A8C2TT61_MCL1-02      accgaggcccgtcgctctgtggagccccgaggaggagttggacggatacg

A0A8C2TT61_MCL1-01      aacccgaatccgaacgaggccccgggggcgattcgttacccggtacaccg
A0A8C2TT61_MCL1-02      aacccgaatccgaacgaggccccgggggcgattcgttacccggtacaccg

A0A8C2TT61_MCL1-01      ccagaactgcccgacgacgagctacggcgggattccttagagctcatcct
A0A8C2TT61_MCL1-02      ccagaactgcccgacgacgagctacggcgggattccttagagctcatcct

A0A8C2TT61_MCL1-01      ccggtatctccgggaagcggcgggagaagcggaacccagcgttaaaaagc
A0A8C2TT61_MCL1-02      ccggtatctccgggaagcggcgggagaagcggaacccagcgttaaaaagc

A0A8C2TT61_MCL1-01      tttttccgggtctattgggtgggcctggacggcccggtaaaacggggaac
A0A8C2TT61_MCL1-02      tttttccgggtctattgggtgggcctggacggcccggtaaaacggggaac

A0A8C2TT61_MCL1-01      ggcgtcatggagaaagcactggaaacgttgaggagggtcggggatggagt
A0A8C2TT61_MCL1-02      ggcgtcatggagaaagcactggaaacgttgaggagggtcggggatggagt

A0A8C2TT61_MCL1-01      gatggagaaacacgagctggcgttccagggaatgcttcggaagctggaaa
A0A8C2TT61_MCL1-02      gatggagaaacacgagctggcgttccagggaatgcttcggaagctggaaa

A0A8C2TT61_MCL1-01      tcaagaaagaagaagatctgcaggcagtttgtgaggtggccgctcacgtt
A0A8C2TT61_MCL1-02      tcaagaaagaagaagatctgcaggcagtttgtgaggtggccgctcacgtt

A0A8C2TT61_MCL1-01      ttcagcgacggagtaacaaactggggccgagttgtcacgctcatctcatt
A0A8C2TT61_MCL1-02      ttcagcgacggagtaacaaactggggccgagttgtcacgctcatctcatt

A0A8C2TT61_MCL1-01      tggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatgca
A0A8C2TT61_MCL1-02      tggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatgca

A0A8C2TT61_MCL1-01      tcagctcgttggcagggatcatcacagacgctttggtctcatccaaacgc
A0A8C2TT61_MCL1-02      tcagctcgttggcagggatcatcacagacgctttggtctcatccaaacgc

A0A8C2TT61_MCL1-01      gagtggctgatgagccagggaggctgggagggttttgtcgacttcttccg
A0A8C2TT61_MCL1-02      gagtggctgatgagccagggaggctgggagggttttgtcgacttcttccg

A0A8C2TT61_MCL1-01      agtcgaggacctggaaggcagcatcaggaacgtgctgatggcctttgctg
A0A8C2TT61_MCL1-02      agtcgaggacctggaaggcagcatcaggaacgtgctgatggcctttgctg

A0A8C2TT61_MCL1-01      gagtggccggcctgggggcgagcttggcctacatgatccgaaagtggagg
A0A8C2TT61_MCL1-02      gagtggccggcctgggggcgagcttggcctacatgatccgc------tgg
                        ****************************************        **

A0A8C2TT61_MCL1-01      agttga
A0A8C2TT61_MCL1-02      acttga
                        * ****

© 1998-2023Legal notice