Dataset for CDS BCL-2-like of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A096MPU7_BCL2-01      atggc--gcacgctgggagaacagggtacgataaccgggagatagtgatg
A0A096NM44_BCL2L10      atggctgacccgttgcgggagc-----gcaccgagcgg------------
A0A096MRS6_MCL1-04      atgtttggcct-caaaagaaac-----gcggtaatcgg------------
A0A096MRS6_MCL1-01      atgtttggcct-caaaagaaac-----gcggtaatcgg------------
A0A096MRS6_MCL1-02      atgtttggcct-caaaagaaac-----gcggtaatcgg------------
A0A096MRS6_MCL1-03      atgtttggcct-caaaagaaac-----gcggtaatcgg------------
                        ***     *          * *      *    * ***            

A0A096MPU7_BCL2-01      aagtacatccactataagctgtcgcagaggggctacgagtgggatgcggg
A0A096NM44_BCL2L10      -------ctcctggccgactatct--ggggtgctgcgcccgggaacc---
A0A096MRS6_MCL1-04      ------actcaacctctactgt-g--ggggggccg-gcttgggggccggc
A0A096MRS6_MCL1-01      ------actcaacctctactgt-g--ggggggccg-gcttgggggccggc
A0A096MRS6_MCL1-02      ------actcaacctctactgt-g--ggggggccg-gcttgggggccggc
A0A096MRS6_MCL1-03      ------actcaacctctactgt-g--ggggggccg-gcttgggggccggc
                                 *        ** *    * ** **   *   ***   *   

A0A096MPU7_BCL2-01      ggatggcgcggcgacccct-------------------------------
A0A096NM44_BCL2L10      --------cggc-acccct-------------------------------
A0A096MRS6_MCL1-04      agcggcggcgcc-acccctccgggagggcggcttttagctacggagaagg
A0A096MRS6_MCL1-01      agcggcggcgcc-acccctccgggagggcggcttttagctacggagaagg
A0A096MRS6_MCL1-02      agcggcggcgcc-acccctccgggagggcggcttttagctacggagaagg
A0A096MRS6_MCL1-03      agcggcggcgcc-acccctccgggagggcggctttta-------------
                                ** * ******                               

A0A096MPU7_BCL2-01      --------------------------------ggggccgcccccgcaccg
A0A096NM44_BCL2L10      ---------------------------gagccgaggccgtc---------
A0A096MRS6_MCL1-04      aggcctcggcccggcgagagatagggggaggggaggccggcacggtgatt
A0A096MRS6_MCL1-01      aggcctcggcccggcgagagatagggggaggggaggccggcacggtgatt
A0A096MRS6_MCL1-02      aggcctcggcccggcgagagatagggggaggggaggccggcacggtgatt
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A096MPU7_BCL2-01      ggcatcttctc---------ctcccagcccgggcacacgccccatcccgc
A0A096NM44_BCL2L10      -----------------------------------cacgcccgaggccgc
A0A096MRS6_MCL1-04      ggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcc-c
A0A096MRS6_MCL1-01      ggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcc-c
A0A096MRS6_MCL1-02      ggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcc-c
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A096MPU7_BCL2-01      cgcgtcccgggacccggtcgccaggacctcgccgctgcc-----------
A0A096NM44_BCL2L10      cgtgctgcg-----------------ctcagcagccgcc-----------
A0A096MRS6_MCL1-04      ggagggtcg-----------------cgcggccgccgcccattggcgcgg
A0A096MRS6_MCL1-01      ggagggtcg-----------------cgcggccgccgcccattggcgcgg
A0A096MRS6_MCL1-02      ggagggtcg-----------------cgcggccgccgcccattggcgcgg
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A096MPU7_BCL2-01      -gaccccggctgcccccgccgccgccgcggggcctgcgctcagcccggtg
A0A096NM44_BCL2L10      ---------aggttacggcagctccaccggtccttcttctccgcctaccg
A0A096MRS6_MCL1-04      aggtccccgacgtcaccgcgacccccgcgaggccgcttttct-----ttg
A0A096MRS6_MCL1-01      aggtccccgacgtcaccgcgacccccgcgaggccgcttttct-----ttg
A0A096MRS6_MCL1-02      aggtccccgacgtcaccgcgacccccgcgaggccgcttttct-----ttg
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A096MPU7_BCL2-01      ccacctgtggtccacctgaccctccgcc---------aggccggtgacga
A0A096NM44_BCL2L10      c--------ggctaccccgggaaccgcgtc-------gagctggtggcgc
A0A096MRS6_MCL1-04      c--------gcccacccgccgcgcggcgccgcttgaggagatggaagccc
A0A096MRS6_MCL1-01      c--------gcccacccgccgcgcggcgccgcttgaggagatggaagccc
A0A096MRS6_MCL1-02      c--------gcccacccgccgcgcggcgccgcttgaggagatggaagccc
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A096MPU7_BCL2-01      cttctcccgccgcta-----------------------------------
A0A096NM44_BCL2L10      tgatggcggaggccgt----------------------------------
A0A096MRS6_MCL1-04      cggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacgag
A0A096MRS6_MCL1-01      cggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacgag
A0A096MRS6_MCL1-02      cggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacgag
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A096MPU7_BCL2-01      ------ccgccgcgacttcgccgagatgtccagcca--------------
A0A096NM44_BCL2L10      ------gctctccgacagc---------cccggccccacctggggcaggg
A0A096MRS6_MCL1-04      ccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggt
A0A096MRS6_MCL1-01      ccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggt
A0A096MRS6_MCL1-02      ccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggt
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A096MPU7_BCL2-01      -gctgcacctgacgcccttcaccgcgcg---gggacgcttt---------
A0A096NM44_BCL2L10      tggtgtcgctggtgaccttcgcg--------gggacgctgctggagagag
A0A096MRS6_MCL1-04      cggggaatctggtaatagccccagtacggatgggtcactaccctcgacgc
A0A096MRS6_MCL1-01      cggggaatctggtaatagccccagtacggatgggtcactaccctcgacgc
A0A096MRS6_MCL1-02      cggggaatctggtaatagccccagtacggatgggtcactaccctcgacgc
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A096MPU7_BCL2-01      -gccac-ggtggtggaggagctcttcagggacggggtgaact--------
A0A096NM44_BCL2L10      agccgctggtgacagcctggt------ggaagaagcggagcttccagccg
A0A096MRS6_MCL1-04      cgccgccagcagaggaggagg------aggacgagttgtaccggcagtcg
A0A096MRS6_MCL1-01      cgccgccagcagaggaggagg------aggacgagttgtaccggcagtcg
A0A096MRS6_MCL1-02      cgccgccagcagaggaggagg------aggacgagttgtaccggcagtcg
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A096MPU7_BCL2-01      --------------------------gggggaggatcgtggcctt-----
A0A096NM44_BCL2L10      cgg------------------ctgaaggagcaggagggcgacgtc-----
A0A096MRS6_MCL1-04      ctggagattatctcttggtaccttcgggagcaggccaccggcgccaagga
A0A096MRS6_MCL1-01      ctggagattatctcttggtaccttcgggagcaggccaccggcgccaagga
A0A096MRS6_MCL1-02      ctggagattatctcttggtaccttcgggagcaggccaccggcgccaagga
A0A096MRS6_MCL1-03      ---------------------------------gccaccggcgccaagga
                                                         *     * *        

A0A096MPU7_BCL2-01      ------------------ctttgagttcggtggggtcatgtgtgtggaga
A0A096NM44_BCL2L10      ------------------gcccgggactgccagcg-------cctggtgg
A0A096MRS6_MCL1-04      cacaaagccaatgggcaggtctggggccaccagcaggaaggctctggaga
A0A096MRS6_MCL1-01      cacaaagccaatgggcaggtctggggccaccagcaggaaggctctggaga
A0A096MRS6_MCL1-02      cacaaagccaatgggcaggtctggggccaccagcaggaaggctctggaga
A0A096MRS6_MCL1-03      cacaaagccaatgggcaggtctggggccaccagcaggaaggctctggaga
                                              * *       *           *** * 

A0A096MPU7_BCL2-01      ----gcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtg
A0A096NM44_BCL2L10      ccttgc--tgagctcg---cggct----cgcggggcagcaccgc------
A0A096MRS6_MCL1-04      ccttacgacgggttggggatggcg----tgcagcgcaaccacga------
A0A096MRS6_MCL1-01      ccttacgacgggttggggatggcg----tgcagcgcaaccacga------
A0A096MRS6_MCL1-02      ccttacgacgggttggggatggcg----tgcagcgcaaccacga------
A0A096MRS6_MCL1-03      ccttacgacgggttggggatggcg----tgcagcgcaaccacga------
                             *         *    * *      *  *  ** *  **       

A0A096MPU7_BCL2-01      gatgactgagtacctgaac------cggcacctgcacacctggatccagg
A0A096NM44_BCL2L10      ---gcctggcttc--aggc-------------------------------
A0A096MRS6_MCL1-04      ---gacggccttccaaggcatgcttcggaaactggacatcaaaaacgaag
A0A096MRS6_MCL1-01      ---gacggccttccaaggcatgcttcggaaactggacatcaaaaacgaag
A0A096MRS6_MCL1-02      ---gacggccttccaaggcatgcttcggaaactggacatcaaaaacgaag
A0A096MRS6_MCL1-03      ---gacggccttccaaggcatgcttcggaaactggacatcaaaaacgaag
                           * * *  * *     *                               

A0A096MPU7_BCL2-01      a---------------------------------------taacggaggc
A0A096NM44_BCL2L10      ---------------------------------------tcag-ggcggc
A0A096MRS6_MCL1-04      acgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggc
A0A096MRS6_MCL1-01      acgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggc
A0A096MRS6_MCL1-02      acgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggc
A0A096MRS6_MCL1-03      acgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggc
                                                                 *  *  ***

A0A096MPU7_BCL2-01      --------------tgggacg-------------cctttgtggaactgta
A0A096NM44_BCL2L10      --------------tgggatggcttttgtcacttcttcaggagccccttt
A0A096MRS6_MCL1-04      gtaacaaactggggcaggattgtgactctcatttcttttggtg-cctttg
A0A096MRS6_MCL1-01      gtaacaaactggggcaggattgtgactctcatttcttttggtg-cctttg
A0A096MRS6_MCL1-02      gtaacaaactggggcaggattgtgactctcatttcttttggtg-cctttg
A0A096MRS6_MCL1-03      gtaacaaactggggcaggattgtgactctcatttcttttggtg-cctttg
                                        ***               * *  *  *  *  * 

A0A096MPU7_BCL2-01      cggc---------------------cccagcatgcggcctctgttt----
A0A096NM44_BCL2L10      ccgctggctttttg-------------gagaaaactgc--tgatcc----
A0A096MRS6_MCL1-04      tggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccatta
A0A096MRS6_MCL1-01      tggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccatta
A0A096MRS6_MCL1-02      tggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccatta
A0A096MRS6_MCL1-03      tggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccatta
                          **                        ** *  * **            

A0A096MPU7_BCL2-01      -----gatttctcctggctgtctctgaagactctgctcagtttggcc---
A0A096NM44_BCL2L10      -----aggctttcctggcatgcttgttagcaacagcct---tcggttatc
A0A096MRS6_MCL1-04      gcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagt
A0A096MRS6_MCL1-01      gcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagt
A0A096MRS6_MCL1-02      gcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagt
A0A096MRS6_MCL1-03      gcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagt
                                     * * *   **    **              **     

A0A096MPU7_BCL2-01      ------------ctgg----------------------------------
A0A096NM44_BCL2L10      t-----------ctgg----------------------------------
A0A096MRS6_MCL1-04      taaacaaagaggctgggctattttttgttccagttcagttgaatactc--
A0A096MRS6_MCL1-01      taaacaaagaggctgggg--------------------------------
A0A096MRS6_MCL1-02      taaacaaagaggctgggatgggttt------------gtggagttcttcc
A0A096MRS6_MCL1-03      taaacaaagaggctgggatgggttt------------gtggagttcttcc
                                    ****                                  

A0A096MPU7_BCL2-01      -------------------------tgggagcttgcatcaccct------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A096MRS6_MCL1-04      -ttcagtggattcaaaccatga----agaaataagtcaccag-----ggg
A0A096MRS6_MCL1-01      --------------------------aaaaacatgcagtcctctagtgtt
A0A096MRS6_MCL1-02      atgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgca
A0A096MRS6_MCL1-03      atgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgca
                                                                          

A0A096MPU7_BCL2-01      ---------------------------gggtgcctatctgggccacaagt
A0A096NM44_BCL2L10      ---------------------------acacgattattatga--------
A0A096MRS6_MCL1-04      aggatagctgaaat-------------acattcctaa-------------
A0A096MRS6_MCL1-01      catgt----------------------gcat-tctgtgggggtga-----
A0A096MRS6_MCL1-02      ggtgttgctggagtaggagctggtttggcatatctaataagatag-----
A0A096MRS6_MCL1-03      ggtgttgctggagtaggagctggtttggcatatctaataagatag-----
                                                          *               

A0A096MPU7_BCL2-01      ga
A0A096NM44_BCL2L10      --
A0A096MRS6_MCL1-04      --
A0A096MRS6_MCL1-01      --
A0A096MRS6_MCL1-02      --
A0A096MRS6_MCL1-03      --
                          

© 1998-2022Legal notice