Dataset for CDS BCL-2-like of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8I5MVB8_BCL2L1-      atgtc------------------tcagagcaaccgggagctggtggttga
A0A096MPU7_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2I3MUE4_BCL2L2-      atgg-----------------------------cga--------------
A0A096NM44_BCL2L10      -------------------------------at-----------------
A0A8I5NQD2_BCL2L10      actgtagagtccttgagag----gccggaccat-----------------
A0A096MRS6_MCL1-04      atgtttggcctcaaaagaa----acgcggtaatcgg--------------
A0A096MRS6_MCL1-01      atgtttggcctcaaaagaa----acgcggtaatcgg--------------
A0A096MRS6_MCL1-02      atgtttggcctcaaaagaa----acgcggtaatcgg--------------
A0A096MRS6_MCL1-03      atgtttggcctcaaaagaa----acgcggtaatcgg--------------
                                                                          

A0A8I5MVB8_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcaattta
A0A096MPU7_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtgggat-------
A0A2I3MUE4_BCL2L2-      -------ccccagcctcggccccagacacac-------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A8I5NQD2_BCL2L10      --------------------------------------------------
A0A096MRS6_MCL1-04      -------actcaacctctactgtgggggggc-------------------
A0A096MRS6_MCL1-01      -------actcaacctctactgtgggggggc-------------------
A0A096MRS6_MCL1-02      -------actcaacctctactgtgggggggc-------------------
A0A096MRS6_MCL1-03      -------actcaacctctactgtgggggggc-------------------
                                                                          

A0A8I5MVB8_BCL2L1-      gtgatgtggaagagaacaggactgaggccccagaagggactgaatcggag
A0A096MPU7_BCL2-01      --------gcgggggatggcgcggcgacccc---tggggccgcccccgca
A0A2I3MUE4_BCL2L2-      ------------------------gggctct---ggtggcagactttgta
A0A096NM44_BCL2L10      -------------------------ggct-------gacccgttgcggga
A0A8I5NQD2_BCL2L10      -------------------------ggct-------gacccgttgcggga
A0A096MRS6_MCL1-04      ------------------------cggcttg---ggggccggcagcggcg
A0A096MRS6_MCL1-01      ------------------------cggcttg---ggggccggcagcggcg
A0A096MRS6_MCL1-02      ------------------------cggcttg---ggggccggcagcggcg
A0A096MRS6_MCL1-03      ------------------------cggcttg---ggggccggcagcggcg
                                                 * *           * *     *  

A0A8I5MVB8_BCL2L1-      atggaga-------cccccagtgccatcaatggcaaccc--------atc
A0A096MPU7_BCL2-01      ccgggcatcttctcctcccagcccgggcacacgccccatcccgccgcgtc
A0A2I3MUE4_BCL2L2-      g-g-----------ttataagctgaggcagaagggttat--------gtc
A0A096NM44_BCL2L10      gcg------------cacc---------gagcggctcct--------ggc
A0A8I5NQD2_BCL2L10      gcg------------cacc---------gagcggctcct--------ggc
A0A096MRS6_MCL1-04      gcg-----------ccacccctccgggagggcggctttt--------agc
A0A096MRS6_MCL1-01      gcg-----------ccacccctccgggagggcggctttt--------agc
A0A096MRS6_MCL1-02      gcg-----------ccacccctccgggagggcggctttt--------agc
A0A096MRS6_MCL1-03      gcg-----------ccacccctccgggagggcggctttt--------a--
                          *                             *                 

A0A8I5MVB8_BCL2L1-      ctggcacctggtggaca--gccccgcggtgaatggagccactggccacag
A0A096MPU7_BCL2-01      ccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccc--
A0A2I3MUE4_BCL2L2-      tgtggagctg---------gccc--------------cggggagggcc--
A0A096NM44_BCL2L10      cgactatctggggtgctgcgccc------------------gggaacc--
A0A8I5NQD2_BCL2L10      cgactatctggggtgctgcgccc------------------gggaacc--
A0A096MRS6_MCL1-04      tacggagaaggaggcctcggcccggcgagagatagggggaggggaggc--
A0A096MRS6_MCL1-01      tacggagaaggaggcctcggcccggcgagagatagggggaggggaggc--
A0A096MRS6_MCL1-02      tacggagaaggaggcctcggcccggcgagagatagggggaggggaggc--
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A8I5MVB8_BCL2L1-      cagcagtttggatgcccgggaggtgatccccatggcagcagtaaagc---
A0A096MPU7_BCL2-01      cgccg-------ccgccgcggggcctgcgctcagcccggtgccacctgtg
A0A2I3MUE4_BCL2L2-      cagca-----------------gctgacccgctgcaccaagccatgc---
A0A096NM44_BCL2L10      cggca----------------------cccctgagccgaggccgtcc---
A0A8I5NQD2_BCL2L10      cggca----------------------cccctgagccgaggccgtcc---
A0A096MRS6_MCL1-04      cggcacggtgattggcggaagcgccggcgcaagccccccggccgccc---
A0A096MRS6_MCL1-01      cggcacggtgattggcggaagcgccggcgcaagccccccggccgccc---
A0A096MRS6_MCL1-02      cggcacggtgattggcggaagcgccggcgcaagccccccggccgccc---
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A8I5MVB8_BCL2L1-      -------aagcgctgagggaggcaggcgacgagtttgaactgcggt----
A0A096MPU7_BCL2-01      gtccacctgaccctccgccaggccggtgacgacttctcccgccgct----
A0A2I3MUE4_BCL2L2-      ----------------gggcagctggagatgagttcgagacccgct----
A0A096NM44_BCL2L10      ---------acgcccgaggccgccgtgctg-cgctcagcagccgcc----
A0A8I5NQD2_BCL2L10      ---------acgcccgaggccgccgtgctg-cgctcagcagccgcc----
A0A096MRS6_MCL1-04      ---------tcacgccagacgcccggagggtcgcgcggccgccgcccatt
A0A096MRS6_MCL1-01      ---------tcacgccagacgcccggagggtcgcgcggccgccgcccatt
A0A096MRS6_MCL1-02      ---------tcacgccagacgcccggagggtcgcgcggccgccgcccatt
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A8I5MVB8_BCL2L1-      ------------------accggcgggcgttcagtgacctgacatcccag
A0A096MPU7_BCL2-01      ------------------accgccgcgacttcgccgagatgtccagccag
A0A2I3MUE4_BCL2L2-      ------------------tccggcgcaccttctctgatctggcggctcag
A0A096NM44_BCL2L10      ----------------aggttacggcagctccaccggtccttcttctccg
A0A8I5NQD2_BCL2L10      ----------------aggttacggcagctccaccggtccttcttctccg
A0A096MRS6_MCL1-04      ggcgcggaggtccccgacgtcaccgcgacccccgcgaggccgcttttct-
A0A096MRS6_MCL1-01      ggcgcggaggtccccgacgtcaccgcgacccccgcgaggccgcttttct-
A0A096MRS6_MCL1-02      ggcgcggaggtccccgacgtcaccgcgacccccgcgaggccgcttttct-
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A8I5MVB8_BCL2L1-      ctccacatcaccccagggacagcatatcagagctttg-----------aa
A0A096MPU7_BCL2-01      ctgcacctgacgcccttcaccgcgcggggacgctttg-----------cc
A0A2I3MUE4_BCL2L2-      ctgcatgtgaccccaggctcagcacagcaacgcttca-----------cc
A0A096NM44_BCL2L10      cctaccgcg--gctaccccgggaaccgcgtc-------gagctggtggcg
A0A8I5NQD2_BCL2L10      cctaccgcg--gctaccccgggaaccgcgtc-------gagctggtggcg
A0A096MRS6_MCL1-04      ----ttgcg--cccacccgccgcgcggcgccgcttgaggagatggaagcc
A0A096MRS6_MCL1-01      ----ttgcg--cccacccgccgcgcggcgccgcttgaggagatggaagcc
A0A096MRS6_MCL1-02      ----ttgcg--cccacccgccgcgcggcgccgcttgaggagatggaagcc
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A8I5MVB8_BCL2L1-      caggtagtgaatg-------------------------------------
A0A096MPU7_BCL2-01      acggtggtggagg-------------------------------------
A0A2I3MUE4_BCL2L2-      caggtctccgatg-------------------------------------
A0A096NM44_BCL2L10      ctgatggcggaggccgt---------------------------------
A0A8I5NQD2_BCL2L10      ctgatggcggaggccgt---------------------------------
A0A096MRS6_MCL1-04      ccggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacga
A0A096MRS6_MCL1-01      ccggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacga
A0A096MRS6_MCL1-02      ccggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacga
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A8I5MVB8_BCL2L1-      ------aactcttccgggat------------ggggtaaactggggtcg-
A0A096MPU7_BCL2-01      ------agctcttcagggac------------ggggtgaactgggggag-
A0A2I3MUE4_BCL2L2-      -----aacttttccaaggg-------------ggccccaactggggccg-
A0A096NM44_BCL2L10      -------gctctccgacagc---------cccggccccacctggggcagg
A0A8I5NQD2_BCL2L10      -------gctctccgacagc---------cccggccccacctggggcagg
A0A096MRS6_MCL1-04      gccggagcctctcgggaagcggccggctgtcctgcccctgctggagttgg
A0A096MRS6_MCL1-01      gccggagcctctcgggaagcggccggctgtcctgcccctgctggagttgg
A0A096MRS6_MCL1-02      gccggagcctctcgggaagcggccggctgtcctgcccctgctggagttgg
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A8I5MVB8_BCL2L1-      --------cattgtggcctttttctccttcggcggg----gcactgtgcg
A0A096MPU7_BCL2-01      --------gatcgtggccttctttgagttcggtggg----gtcatgtgtg
A0A2I3MUE4_BCL2L2-      --------ccttgtagccttctttgtctttgggg----ctgcactgtgtg
A0A096NM44_BCL2L10      gtggtgtcgctggtgaccttcgcg--------gggacgctgctggagaga
A0A8I5NQD2_BCL2L10      gtggtgtcgctggtgaccttcgcg--------gggacgctgctggagaga
A0A096MRS6_MCL1-04      tcggggaatctggtaatagccccagtacggatgggtcactaccctcgacg
A0A096MRS6_MCL1-01      tcggggaatctggtaatagccccagtacggatgggtcactaccctcgacg
A0A096MRS6_MCL1-02      tcggggaatctggtaatagccccagtacggatgggtcactaccctcgacg
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A8I5MVB8_BCL2L1-      tggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcag-c
A0A096MPU7_BCL2-01      tggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccc-t
A0A2I3MUE4_BCL2L2-      ctgagagtgtcaacaaggagatggaaccactggtg-ggacaagtgcagga
A0A096NM44_BCL2L10      gagccgctggtgacagcctggtggaagaagcggagcttccagccgcgg--
A0A8I5NQD2_BCL2L10      gagccgctggtgacagcctggtggaagaagcggagcttccagccgcgg--
A0A096MRS6_MCL1-04      ccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctgga
A0A096MRS6_MCL1-01      ccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctgga
A0A096MRS6_MCL1-02      ccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctgga
A0A096MRS6_MCL1-03      --------------------------------------------------
                                                                          

A0A8I5MVB8_BCL2L1-      ttggatggccacttacctgaatgaccac----ctagagcc----------
A0A096MPU7_BCL2-01      gtggatgactgagtacctgaa-----------ccggcacc----------
A0A2I3MUE4_BCL2L2-      gtggatggtggcctacctggagacgcggctggctgac-------------
A0A096NM44_BCL2L10      ----------------ctgaaggagcaggagggcgacgtc----------
A0A8I5NQD2_BCL2L10      ----------------ctgaaggagcaggagggcgacgtc----------
A0A096MRS6_MCL1-04      gattatctcttggtaccttcgggagcaggccaccggcgccaaggacacaa
A0A096MRS6_MCL1-01      gattatctcttggtaccttcgggagcaggccaccggcgccaaggacacaa
A0A096MRS6_MCL1-02      gattatctcttggtaccttcgggagcaggccaccggcgccaaggacacaa
A0A096MRS6_MCL1-03      ----------------------------gccaccggcgccaaggacacaa
                                                                          

A0A8I5MVB8_BCL2L1-      ---------------ttggatccaggagaacgg-----------------
A0A096MPU7_BCL2-01      --------tgcacacctggatccaggataacgg-----------------
A0A2I3MUE4_BCL2L2-      -----------------tggatcc--acagcag--------tgg------
A0A096NM44_BCL2L10      -------------gcccgggactg--ccagcg-------cctggtggcct
A0A8I5NQD2_BCL2L10      -------------gcccgggactg--ccagcg-------cctggtggcct
A0A096MRS6_MCL1-04      agccaatgggcaggtctggggcca--ccagcaggaaggctctggagacct
A0A096MRS6_MCL1-01      agccaatgggcaggtctggggcca--ccagcaggaaggctctggagacct
A0A096MRS6_MCL1-02      agccaatgggcaggtctggggcca--ccagcaggaaggctctggagacct
A0A096MRS6_MCL1-03      agccaatgggcaggtctggggcca--ccagcaggaaggctctggagacct
                                          *         * *                   

A0A8I5MVB8_BCL2L1-      ------cggctgggacacttttgtggaactctatgggaaca--------a
A0A096MPU7_BCL2-01      ------aggctgggacgcctttgtggaactgtacggccccagcatgcgg-
A0A2I3MUE4_BCL2L2-      ------gggctgggcggagttcacagctctatacggggacggggccctgg
A0A096NM44_BCL2L10      tgc--tgagctcg---cggctcgcggggcagcaccgcgcctggcttc--a
A0A8I5NQD2_BCL2L10      tgc--tgagctcg---cggctcgcggggcagcaccgcgcctggcttc--a
A0A096MRS6_MCL1-04      tacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaa
A0A096MRS6_MCL1-01      tacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaa
A0A096MRS6_MCL1-02      tacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaa
A0A096MRS6_MCL1-03      tacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaa
                                * * *            *  *      *   *          

A0A8I5MVB8_BCL2L1-      tgcagcagccgagagccgaaag---------------------------g
A0A096MPU7_BCL2-01      -------------------------------------------------c
A0A2I3MUE4_BCL2L2-      aggaggcgcgg--------------------------------------c
A0A096NM44_BCL2L10      ggc-----------------------------------------------
A0A8I5NQD2_BCL2L10      ggc-----------------------------------------------
A0A096MRS6_MCL1-04      ggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcttt
A0A096MRS6_MCL1-01      ggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcttt
A0A096MRS6_MCL1-02      ggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcttt
A0A096MRS6_MCL1-03      ggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcttt
                                                                          

A0A8I5MVB8_BCL2L1-      gccaggagcgcttcaaccgctggttcctgacg---------------ggc
A0A096MPU7_BCL2-01      ctctgtttgatttctcctggctgtctctgaagactctgctcagtttggcc
A0A2I3MUE4_BCL2L2-      gtctgcgggaggggaactgggcatcagtgaggacagtgct-gacgggggc
A0A096NM44_BCL2L10      -----------------------tcag-ggcggc---------------t
A0A8I5NQD2_BCL2L10      -----------------------tcag-ggcggc---------------t
A0A096MRS6_MCL1-04      gtctcgagtgatggtccatgttttcagcgacggcgtaaca-aactggggc
A0A096MRS6_MCL1-01      gtctcgagtgatggtccatgttttcagcgacggcgtaaca-aactggggc
A0A096MRS6_MCL1-02      gtctcgagtgatggtccatgttttcagcgacggcgtaaca-aactggggc
A0A096MRS6_MCL1-03      gtctcgagtgatggtccatgttttcagcgacggcgtaaca-aactggggc
                                               *    *  *                  

A0A8I5MVB8_BCL2L1-      atgactgtggccggcgtggttctgctaggctcac----------------
A0A096MPU7_BCL2-01      ctggtgggagcttgcatcaccctgggtgcctatc----------------
A0A2I3MUE4_BCL2L2-      cg---------tggcact------gggggccct-----------------
A0A096NM44_BCL2L10      gggatggcttttgtcacttcttcaggagcccctttccgctggctttttg-
A0A8I5NQD2_BCL2L10      gggatggcttttgtcacttcttcaggagcccctttccgctggctttttg-
A0A096MRS6_MCL1-04      aggattgtgactctcatttcttttggtg-cctttgtggctaaacacttga
A0A096MRS6_MCL1-01      aggattgtgactctcatttcttttggtg-cctttgtggctaaacacttga
A0A096MRS6_MCL1-02      aggattgtgactctcatttcttttggtg-cctttgtggctaaacacttga
A0A096MRS6_MCL1-03      aggattgtgactctcatttcttttggtg-cctttgtggctaaacacttga
                                      *            * *                    

A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A096MPU7_BCL2-01      -------------------------tgggcc-------------------
A0A2I3MUE4_BCL2L2-      --------------ggtaactgtaggggcct-------------------
A0A096NM44_BCL2L10      ------------gagaaaactgc--tgatcc---------aggctttcct
A0A8I5NQD2_BCL2L10      ------------gagaaaactgc--tgatcc---------aggctttcct
A0A096MRS6_MCL1-04      agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcaca
A0A096MRS6_MCL1-01      agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcaca
A0A096MRS6_MCL1-02      agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcaca
A0A096MRS6_MCL1-03      agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcaca
                                                                          

A0A8I5MVB8_BCL2L1-      ----tcttcagtcggaaatga-----------------------------
A0A096MPU7_BCL2-01      -------------acaagtga-----------------------------
A0A2I3MUE4_BCL2L2-      ----tttttgctagcaagtga-----------------------------
A0A096NM44_BCL2L10      ggcatgcttgttagcaacagcct---tcggttatct-----------ctg
A0A8I5NQD2_BCL2L10      ggcatgcttgttagcaacagcct---tcggttatct-----------ctg
A0A096MRS6_MCL1-04      gacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctg
A0A096MRS6_MCL1-01      gacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctg
A0A096MRS6_MCL1-02      gacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctg
A0A096MRS6_MCL1-03      gacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctg
                                       *                                  

A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A096NM44_BCL2L10      g-------------------------------------------------
A0A8I5NQD2_BCL2L10      g-------------------------------------------------
A0A096MRS6_MCL1-04      ggctattttttgttccagttcagttgaatactc---ttcagtggattcaa
A0A096MRS6_MCL1-01      ggg-----------------------------------------------
A0A096MRS6_MCL1-02      ggatgggttt------------gtggagttcttccatgtagaggacctag
A0A096MRS6_MCL1-03      ggatgggttt------------gtggagttcttccatgtagaggacctag
                                                                          

A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A096NM44_BCL2L10      --------------------------------------------------
A0A8I5NQD2_BCL2L10      --------------------------------------------------
A0A096MRS6_MCL1-04      accatga----agaaataagtcaccag-----gggaggatagctgaaat-
A0A096MRS6_MCL1-01      -----------aaaaacatgcagtcctctagtgttcatgt----------
A0A096MRS6_MCL1-02      aaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagta
A0A096MRS6_MCL1-03      aaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagta
                                                                          

A0A8I5MVB8_BCL2L1-      ------------------------------
A0A096MPU7_BCL2-01      ------------------------------
A0A2I3MUE4_BCL2L2-      ------------------------------
A0A096NM44_BCL2L10      ------------acacgattattatga---
A0A8I5NQD2_BCL2L10      ------------acacgattattatga---
A0A096MRS6_MCL1-04      ------------acattcctaa--------
A0A096MRS6_MCL1-01      ------------gcat-tctgtgggggtga
A0A096MRS6_MCL1-02      ggagctggtttggcatatctaataagatag
A0A096MRS6_MCL1-03      ggagctggtttggcatatctaataagatag
                                                      

© 1998-2023Legal notice