Dataset for CDS BCL2A1 of organism Salvator merianae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8D0EB90_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Salvator merianae GN=BCL2A1 (length=483 residues).
atggaaagctgtgagcacctttatgtttacagtctggttgaagattacttgaaatatgtttctcaggaaacaatgtttga
agctcctccaagcagagctgctgaagtcttgcgcaaaattgcgccttcacttcaagaagaagttgagaagaaattggaac
tgttgtgggactcagttgagatcacttctgttgacaaagccagtaaaatattcaacaaagtgatggaagaggaattttct
gatggaaacaccaactgggggcgaattgtgacaatattcctgtttggaggaattcttgccaaaaaactacaaaaacaagg
agtcgttttgacaaaagaaaatacaagagagatttctcacttcattgcagactatatcattaatactaaagcaaagtgga
tccatgaaaatggaggatgggtaagtaattcttatgctcaaattttatttaacaccatcatatcccttgtaagaaaatat
tag
© 1998-2023Legal notice