Dataset for CDS BCL-2-like of organism Pavo cristatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9EN38_BCL2L1-      atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagct
A0A8C9EP12_MCL1-01      atgtttgccgtcaagcggaacgccgtcatcggcttcaacctcta----ct
A0A8C9L7I6_BCL2-01      atggct------------------------------------ca----cc
                        ***                                        *    * 

A0A8C9EN38_BCL2L1-      ctcgcagaaggggc---------------------actgctggagc----
A0A8C9EP12_MCL1-01      gcggcggaggaggcccgggcctggtgcccgcttcaccagcaggagaccaa
A0A8C9L7I6_BCL2-01      ccgggagaagagg--------------ctacgacaaccgcgagata----
                           *  ** * **                       * **  **      

A0A8C9EN38_BCL2L1-      ----------------------------------------gagctggagg
A0A8C9EP12_MCL1-01      accccgccgcccgccgccgccgccccggccgccgccaccgccgctgaggt
A0A8C9L7I6_BCL2-01      ----------------------------------------gtgctgaagt
                                                                  ****  * 

A0A8C9EN38_BCL2L1-      a----------agaggatgagaacaggactgacactg------cggcaga
A0A8C9EP12_MCL1-01      accgcggccgctgattggctccgcggggttg----tgggccgccgccggc
A0A8C9L7I6_BCL2-01      acatccactataaactctcgcagcggggctacgattgggccgccggcgag
                        *            *         * **  *     **      ** *   

A0A8C9EN38_BCL2L1-      ggc--agagatggacagcgtcctcaatgg----gagcccgtc--------
A0A8C9EP12_MCL1-01      cgcgccgaagccccccacgctcccattggctccgaggcggccccccactc
A0A8C9L7I6_BCL2-01      gac----aggccgcccgtgcccc--------------cggcc--------
                          *    *      *   *  *               * * *        

A0A8C9EN38_BCL2L1-      -----ctggcacc----------------ctcctgccggccacgtagtga
A0A8C9EP12_MCL1-01      tctgactggctccgaggaggccccccgcgctccgattggttccgccgcgg
A0A8C9L7I6_BCL2-01      -----ctggctcc--------------cgctgc---tgctcccgccgcgg
                             ***** **                ** *    *    **  * * 

A0A8C9EN38_BCL2L1-      --------------atgga------gccaccgtgcaccg-------gagc
A0A8C9EP12_MCL1-01      cccgccgggcgccgccggactccacgccgcggcccgtcgcgctgtggagc
A0A8C9L7I6_BCL2-01      -----tggctgctgctgga------gcctcctcccatcaccgccccgagc
                                        ***      *** *    *  *        ****

A0A8C9EN38_BCL2L1-      agcctggaa---------gttcaccaaattg--ttcgag--------cat
A0A8C9EP12_MCL1-01      cccgaggaggagttggacggctgcgagcccgagtccgagcgagg---ccc
A0A8C9L7I6_BCL2-01      cccccggct--------cggctgc---------tgctagtgaggtgcccc
                          *  **           *    *         * * **        *  

A0A8C9EN38_BCL2L1-      ctgacgtgaggcag-------------------------------gcgct
A0A8C9EP12_MCL1-01      cggaggcgattcattgcccagcacgcctcccgagctgcccgacgagctgc
A0A8C9L7I6_BCL2-01      cggctgaggggctgcgccc--cgcgcctcccgg--cgtccacctcgccct
                        * *  * *   *                                 **   

A0A8C9EN38_BCL2L1-      gagagaagcag----gggat------gagttcgagctgaggtaccggagg
A0A8C9EP12_MCL1-01      ccgacgagctgcggcgggactctttggagctcatcctccggtacctccgg
A0A8C9L7I6_BCL2-01      gcgccaggccg----gggac------gagttctcgcgccgctaccagagg
                          *    ** *    ****       *** **   *   * ****   **

A0A8C9EN38_BCL2L1-      g-------------------------------------ctttc-------
A0A8C9EP12_MCL1-01      gaggcggcgggagaagccgagcccggcgttaaaaagctctttccggggct
A0A8C9L7I6_BCL2-01      ga------------------------------------cttt--------
                        *                                     ****        

A0A8C9EN38_BCL2L1-      ------agcgacctcacctc---------ccagctccaca----------
A0A8C9EP12_MCL1-01      cctgggagggcccgggcggcccggcagggcgggcagcgccgtcatggaga
A0A8C9L7I6_BCL2-01      ---------gcccagatgtc------gggccagctgcacc----------
                                 * **      *         *  **  * *           

A0A8C9EN38_BCL2L1-      ------------------------------------tcaccc--------
A0A8C9EP12_MCL1-01      aagcgctagaaacgttgcggagggtcggggacggcgtgatgcagaaacac
A0A8C9L7I6_BCL2-01      ------------------------------------tgacgc--------
                                                            * *  *        

A0A8C9EN38_BCL2L1-      -------ctggc-------------------------------------a
A0A8C9EP12_MCL1-01      gagttggccttccaggggatgcttcggaagctggaaatcaaaaaggaaga
A0A8C9L7I6_BCL2-01      -------ccttc-------------------------------------a
                               *   *                                     *

A0A8C9EN38_BCL2L1-      cggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggt
A0A8C9EP12_MCL1-01      agatctgcagtcggtgtgtga-ggtggctgcgcacgtttttagtgacgga
A0A8C9L7I6_BCL2-01      cggcccacggccgcttcgtggccgtggtggaggagctcttccgtgatggg
                         *     *    * *  * *   ** *      *  * **   *** ** 

A0A8C9EN38_BCL2L1-      gt---gaactgggggcgcatcgtggctttcttctccttcggaggg-----
A0A8C9EP12_MCL1-01      gtaacaaactggggccgagttgtcacactcatctcatttggtgcctttgt
A0A8C9L7I6_BCL2-01      gt---caactggggccggatcgtcgccttcttcgagttcggcggc-----
                        **    ******** **  * **  *  ** **   ** ** *       

A0A8C9EN38_BCL2L1-      -gctttgtgcgtggagagcgtggacaaggagatgcggg-------tactg
A0A8C9EP12_MCL1-01      tgcaaaacacctgaaaagcatcaaccaggagaagt-gcattggctcgctg
A0A8C9L7I6_BCL2-01      -gtgatgtgcgtcgagagcgtcaaccgggagatgtcgc-------cgctg
                         *       * *  * *** *  **  ***** *  *          ***

A0A8C9EN38_BCL2L1-      gtgggacgcattgtgtcttggatgaccacgtacttgaccgaccatctaga
A0A8C9EP12_MCL1-01      gcagggatcatcac-----agatgctttggt--ctcatccaa-----acg
A0A8C9L7I6_BCL2-01      gtggacaacattgccacctggatgaccgagtacctgaaccggcacctgca
                        *  *    ***         ****     **   * * *           

A0A8C9EN38_BCL2L1-      tccctggatccaggagaatggcggctgggagcgctttgt-----------
A0A8C9EP12_MCL1-01      cgagtggctgatgagccagggaggctgggagggctttgtcgacttcttcc
A0A8C9L7I6_BCL2-01      caactggatccaggacaacggaggatgggatgcctttgt-----------
                            *** *   *    * ** ** *****   ******           

A0A8C9EN38_BCL2L1-      -------ggacctgtacgggaacaacgctgctgccgagctgaggaagggc
A0A8C9EP12_MCL1-01      gagttgaggacctggaaagcagcatc---------------aggaacgtg
A0A8C9L7I6_BCL2-01      -------ggaattgtatggcaacagt---------------atga-----
                               ***  ** *  * * **                 * **     

A0A8C9EN38_BCL2L1-      caggagaccttcaacaaatggctcct-gacc------ggggcgaccgtg-
A0A8C9EP12_MCL1-01      ctgatggcctttgcaggagt-------ggccggcctgggggcgagcttg-
A0A8C9L7I6_BCL2-01      -----ggcctttgttcgatttctcctggatctctctgaagaccatcctga
                             * ****      *         *  *        * * * * ** 

A0A8C9EN38_BCL2L1-      gccgg-------agtgcttctgctgg---------gatccctg-------
A0A8C9EP12_MCL1-01      gcctacatgatccgttatgcagctggacttgagctgaaccctggagaata
A0A8C9L7I6_BCL2-01      gcctg--------gttctg--gtgggagcttgcatcactcttggcgctta
                        ***          **  *   *  **          *  * **       

A0A8C9EN38_BCL2L1-      -ctgagccgcaagtga
A0A8C9EP12_MCL1-01      tctaggcatcccctga
A0A8C9L7I6_BCL2-01      tcttggacataagtag
                         **  *       *  

© 1998-2022Legal notice