Dataset for CDS BCL-2-like of organism Ursus americanus

[Download (right click)] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A452RHX5_MCL1-01         atgtt----------------tggcctgaagagaa-acgcagtaatcgg-
A0A452SDS4_BCL2L1-01       atgtc----------------tcagagcaa------------ccgg----
A0A452SHI1_BCL2L2-01       atggcgaccccagcctcagccccag-acac------------acgg----
A0A452R110_BCL2-01         atgcc----------------ggagacgcgggcgccgcgcccccgggggc
A0A452R110_BCL2-02         atgcc----------------ggagacgcgggcgccgcgcccccgggggc
A0A452QJG0_BCL2L10-01      atggc----------------ggacgcgctgagggagcgcacggcgcggc
A0A452SIR9_BCL2A1-01       atgac----------------agactgtgagttcgggtacaccctgacgc
                           ***                                               

A0A452RHX5_MCL1-01         -actca-----acctctactgtgggggggccgggttgggggccggcagcg
A0A452SDS4_BCL2L1-01       -gagctggtggttgactttctctcctac-----------------aagct
A0A452SHI1_BCL2L2-01       -gctctagtggcagactttgtaggctat-----------------aagct
A0A452R110_BCL2-01         cgcccccgcgccgggcatcttctcctcc-----------------cagcc
A0A452R110_BCL2-02         cgcccccgcgccgggcatcttctcctcc-----------------cagcc
A0A452QJG0_BCL2L10-01      tgctga-----ccgactacctggagtac----------------------
A0A452SIR9_BCL2A1-01       tggccc-----aggactacgtgaagcac----------------------
                                          *                                  

A0A452RHX5_MCL1-01         gcggcgccgcctcatcgggagggcggcttttggcttcggggaaggaggcc
A0A452SDS4_BCL2L1-01       ttcc----------------------------------------------
A0A452SHI1_BCL2L2-01       gagg----------------------------------------------
A0A452R110_BCL2-01         tggg----------------------------------------------
A0A452R110_BCL2-02         tggg----------------------------------------------
A0A452QJG0_BCL2L10-01      --------------------------------------------------
A0A452SIR9_BCL2A1-01       --------------------------------------------------
                                                                             

A0A452RHX5_MCL1-01         acggcccggcgggaggtagggggaggggaagccggtgcggtgattggcgg
A0A452SDS4_BCL2L1-01       ---------cagaaaggata--cagctggagtcagtttagtgatgtggaa
A0A452SHI1_BCL2L2-01       ---------cagaaaggtta--tgtgtgtggag-----------------
A0A452R110_BCL2-01         ---------c----------------------------------------
A0A452R110_BCL2-02         ---------c----------------------------------------
A0A452QJG0_BCL2L10-01      --------------------------------------------------
A0A452SIR9_BCL2A1-01       --------------------------------------------------
                                                                             

A0A452RHX5_MCL1-01         aagcgccggcgctagtcccccggccactctcgcgccg-----g-acgccc
A0A452SDS4_BCL2L1-01       gagaacagaactgaggccccagaaggaactgaatcagagatggagacccc
A0A452SHI1_BCL2L2-01       --------------------------------------------------
A0A452R110_BCL2-01         --------------------------------------------tcaccc
A0A452R110_BCL2-02         --------------------------------------------tcaccc
A0A452QJG0_BCL2L10-01      --------------------------------------------------
A0A452SIR9_BCL2A1-01       --------------------------------------------------
                                                                             

A0A452RHX5_MCL1-01         ggagggtcgcgcggccctcgcccattgg----------cgccgaggg---
A0A452SDS4_BCL2L1-01       cagtgccatcaatggcaacccatcctggcacttggcggacagccctgcgg
A0A452SHI1_BCL2L2-01       --------------------------------------ctggccctgggg
A0A452R110_BCL2-01         ccgcgcccgccaggacctcgccgcttac----------cgcccccgg---
A0A452R110_BCL2-02         ccgcgcccgccaggacctcgccgcttac----------cgcccccgg---
A0A452QJG0_BCL2L10-01      -------------------tgcgcccgg----------gagcccggc---
A0A452SIR9_BCL2A1-01       -------------------gtcctgcag-----------a-tcccgc---
                                                                             

A0A452RHX5_MCL1-01         -------tcccgacgtcacggcgacccccccgaggctactgttcctcgag
A0A452SDS4_BCL2L1-01       tgaatggagcc---------------------------------------
A0A452SHI1_BCL2L2-01       aggg----------------------------------------------
A0A452R110_BCL2-01         -------ccgc---------------------------------------
A0A452R110_BCL2-02         -------ccgc---------------------------------------
A0A452QJG0_BCL2L10-01      -------accc---------------------------------------
A0A452SIR9_BCL2A1-01       -------agcc---------------------------------------
                                                                             

A0A452RHX5_MCL1-01         cccacccgccgcgcgtcgccgcctgaagagatggaaggcccagccgccga
A0A452SDS4_BCL2L1-01       -----------------------------------------actggccac
A0A452SHI1_BCL2L2-01       --------------------------------------------------
A0A452R110_BCL2-01         -----------------------------------------ccccgccgc
A0A452R110_BCL2-02         -----------------------------------------ccccgccgc
A0A452QJG0_BCL2L10-01      -----------------------------------------ctgcgcggg
A0A452SIR9_BCL2A1-01       -----------------------------------------gggctcagc
                                                                             

A0A452RHX5_MCL1-01         -cgccatca---tgtcgcccgaagaggagctggacgggtacgagccggaa
A0A452SDS4_BCL2L1-01       agcagcag-ct-tggatgcccgggaggtgatccccatggcag--------
A0A452SHI1_BCL2L2-01       ------------------cccagcag----------ctgacc--------
A0A452R110_BCL2-01         cgccgccgccg-ccgcgggccctgcgctcagccccgtgccac--------
A0A452R110_BCL2-02         cgccgccgccg-ccgcgggccctgcgctcagccccgtgccac--------
A0A452QJG0_BCL2L10-01      cgccgtccacgcccgaggccgcggtgctgcgctcggtggccg--------
A0A452SIR9_BCL2A1-01       -cccgagca---gggcgtcccaggtgctgcgggacgtggcct--------
                                              *     *                        

A0A452RHX5_MCL1-01         cctttggggaagcggccggctgtcctgcctttgctggagttggtcgggga
A0A452SDS4_BCL2L1-01       --------------------------------------------------
A0A452SHI1_BCL2L2-01       --------------------------------------------------
A0A452R110_BCL2-01         --------------------------------------------------
A0A452R110_BCL2-02         --------------------------------------------------
A0A452QJG0_BCL2L10-01      --------------------------------------------------
A0A452SIR9_BCL2A1-01       --------------------------------------------------
                                                                             

A0A452RHX5_MCL1-01         ggccagcggtggcccttgtacggacggctcactgccctcgacgccacccc
A0A452SDS4_BCL2L1-01       ------cag-----------------------------------------
A0A452SHI1_BCL2L2-01       ------cac-----------------------------------------
A0A452R110_BCL2-01         ------ctg---------------------------------------tg
A0A452R110_BCL2-02         ------ctg---------------------------------------tg
A0A452QJG0_BCL2L10-01      ------ccc---------------------------------------ag
A0A452SIR9_BCL2A1-01       ------cct---------------------------------------cc
                                 *                                           

A0A452RHX5_MCL1-01         cagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatc
A0A452SDS4_BCL2L1-01       -tga----------------------------------------------
A0A452SHI1_BCL2L2-01       -tgc----------------------------------------------
A0A452R110_BCL2-01         gtcc----------------------------------------------
A0A452R110_BCL2-02         gtcc----------------------------------------------
A0A452QJG0_BCL2L10-01      gtcc----------------------------------------------
A0A452SIR9_BCL2A1-01       gtgc----------------------------------------------
                                                                             

A0A452RHX5_MCL1-01         tctcggtaccttcgggagcaggcaacaggcgccaaggacgcgaaaccgct
A0A452SDS4_BCL2L1-01       --------------------------------------------------
A0A452SHI1_BCL2L2-01       --------------------------------------------------
A0A452R110_BCL2-01         --------------------------------------------------
A0A452R110_BCL2-02         --------------------------------------------------
A0A452QJG0_BCL2L10-01      --------------------------------------------------
A0A452SIR9_BCL2A1-01       --------------------------------------------------
                                                                             

A0A452RHX5_MCL1-01         gggcgggtctggggcggccagccggaaggcgttagagaccctccgacggg
A0A452SDS4_BCL2L1-01       --------------------------------agcaagcgctgagggagg
A0A452SHI1_BCL2L2-01       --------------------------------accaagccatgcgggcag
A0A452R110_BCL2-01         --------------------------------acctgaccctgcgccagg
A0A452R110_BCL2-02         --------------------------------acctgaccctgcgccagg
A0A452QJG0_BCL2L10-01      --------------------------------agcagcgt---cacgagc
A0A452SIR9_BCL2A1-01       --------------------------------agggggag---gtggaaa
                                                                             

A0A452RHX5_MCL1-01         tcggggacggggtacagcg--------------caaccacgagacggcct
A0A452SDS4_BCL2L1-01       ccggggatgagttcgaact--------------gaggtaccggcgggcat
A0A452SHI1_BCL2L2-01       ctggagatgagtttgagac--------------ccgcttccggcgcacct
A0A452R110_BCL2-01         ccggcgatgacttctcccg--------------tcgctaccgccgcgact
A0A452R110_BCL2-02         ccggcgatgacttctcccg--------------tcgctaccgccgcgact
A0A452QJG0_BCL2L10-01      acttcttgtccgattaccg--------------cggctacggcggcaacc
A0A452SIR9_BCL2A1-01       agaacttgaaaccatgcctggacagtttcgatgtggtgtccgtcgactcc
                                                                  *          

A0A452RHX5_MCL1-01         tccaaggca-tgcttcggaaactggacatcaaaaac-gaagacgatgtca
A0A452SDS4_BCL2L1-01       tcagcgacc-tgacatcccagcttcacatcaccccagggacagcgtatca
A0A452SHI1_BCL2L2-01       tctctgatt-tggcagcccagctgcatgtgaccccaggctcagcccagca
A0A452R110_BCL2-01         tcgcggaga-tgtccagccagctgcacctgacacccttcaccgcaagggg
A0A452R110_BCL2-02         tcgcggaga-tgtccagccagctgcacctgacacccttcaccgcaagggg
A0A452QJG0_BCL2L10-01      gcgtggagc-tggtggctca------------------------------
A0A452SIR9_BCL2A1-01       gccagaaccatattcaatca------------------------------
                            *        *        *                              

A0A452RHX5_MCL1-01         aatctttgtctcgagtgatggtccatgttttcagtgac------ggagta
A0A452SDS4_BCL2L1-01       gagctttgagca-ggtagtgaatgaactcttccgggat------ggggt-
A0A452SHI1_BCL2L2-01       acgcttcaccca-ggtctctgacgaactcttccaaggg------ggccc-
A0A452R110_BCL2-01         acgctttgccac-ggtggtggaggagctcttcagggat------ggggt-
A0A452R110_BCL2-02         acgctttgccac-ggtggtggaggagctcttcagggat------ggggt-
A0A452QJG0_BCL2L10-01      -------------ggtggagcgggagatactcgcccacccccagcccct-
A0A452SIR9_BCL2A1-01       -------------ggtcatggaaaaggaatttgaagacgg---catcat-
                                         **        *     *                   

A0A452RHX5_MCL1-01         acaaactggggcaggattgtgactcttatttcttttggtgcctttgtggc
A0A452SDS4_BCL2L1-01       --gaactggggtcgcattgtggcctttttctccttcggtggggc------
A0A452SHI1_BCL2L2-01       --caactggggccgcctggtggccttctttgtctttggagccgc------
A0A452R110_BCL2-01         --gaactgggggaggattgtggccttctttgagttcggtggggt------
A0A452R110_BCL2-02         --gaactgggggaggattgtggccttctttgagttcggtggggt------
A0A452QJG0_BCL2L10-01      --aagctggggccgtgtggtggcgctcctcaccttcgcgggcac------
A0A452SIR9_BCL2A1-01       --taactggggaagaattgtgaccatatttgcgttcgaagggat------
                              * ******  *  * *** *  *  *    ** *  *          

A0A452RHX5_MCL1-01         caaacacttgaagagt--ataaaccaagaaagctgcatcgaacca-----
A0A452SDS4_BCL2L1-01       attgtgcgtggagagc--gtagacaaggagatgc--aggtattggtg---
A0A452SHI1_BCL2L2-01       actgtgtgctgagagt--gtcaacaaagagatgg--agccacttgtg---
A0A452R110_BCL2-01         catgtgtgtggagagc--gtcaaccgggagatgt--cgcccctggtg---
A0A452R110_BCL2-02         catgtgtgtggagagc--gtcaaccgggagatgt--cgcccctggtg---
A0A452QJG0_BCL2L10-01      actgctggagagatcgccgtcggggacctactcg--aacctggggccgga
A0A452SIR9_BCL2A1-01       tctcaccaagaaactc--ctccaggagcgaatct--ccccggatgtg---
                                              *                              

A0A452RHX5_MCL1-01         --------------------------------------------ttagca
A0A452SDS4_BCL2L1-01       --------------------------------agt------cggatcgca
A0A452SHI1_BCL2L2-01       --------------------------------gga------caagtgcaa
A0A452R110_BCL2-01         --------------------------------gac------aacattgcc
A0A452R110_BCL2-02         --------------------------------gac------aacattgcc
A0A452QJG0_BCL2L10-01      ccaggaactggagctgggggagcgggaggccggcgtccgccaggactgcc
A0A452SIR9_BCL2A1-01       --------------------------------gacgcttctaggatttct
                                                                             

A0A452RHX5_MCL1-01         -----------gaaagcatcacagatgttctcgtaaggacaaaacgagac
A0A452SDS4_BCL2L1-01       -----------acttggatggccacttacctgaacgaccacctagagcct
A0A452SHI1_BCL2L2-01       -----------gagtggatggtggcctacctggagacacggctggctgac
A0A452R110_BCL2-01         -----------ctgtggatgactgagtacctgaaccggcacctgcacacc
A0A452R110_BCL2-02         -----------ctgtggatgactgagtacctgaaccggcacctgcacacc
A0A452QJG0_BCL2L10-01      ggcacctggtggacttcctctgcaatcggctcacgggacagcatcgcgcc
A0A452SIR9_BCL2A1-01       -----------tacttcgtggcagagttcatcacgacaaacatgagagag
                                             *           *                   

A0A452RHX5_MCL1-01         tggctagtcaaacaaagaggctgggatgggtttgtgga---gttcttcca
A0A452SDS4_BCL2L1-01       tggatccaggagaacggcggctgggacactttcgtgga---actctacgg
A0A452SHI1_BCL2L2-01       tggatccacagcagtgggggctgggcggagttcacagc---tctatacgg
A0A452R110_BCL2-01         tggatccaggacaacggaggctgggatgcctttgtgga---gttgtacgg
A0A452R110_BCL2-02         tggatccaggacaacggaggctgggcac----------------------
A0A452QJG0_BCL2L10-01      tggctggaggcgcacgacggctgggtgaatggcttttgtctcttcttcac
A0A452SIR9_BCL2A1-01       tggataaggcagaacggaggctgggaagatggctttgtaaagaagttcga
                           *** *             *******                         

A0A452RHX5_MCL1-01         tgtagaggacctaga-------aggtggcatca-----gaaatgtgctgc
A0A452SDS4_BCL2L1-01       gaacaat---gcagcggctgaaagccggaagggcc-aggagcgcttcaac
A0A452SHI1_BCL2L2-01       ggacggg---gccctggaggaggcgcggcgtctgc-gggaggggaactgg
A0A452R110_BCL2-01         ccccagc---------------atgcagcctctgt-ttgacttctcctgg
A0A452R110_BCL2-02         --------------------------------------------------
A0A452QJG0_BCL2L10-01      acccatg----------ctggccgtccgtcttggaaaagactgctggccc
A0A452SIR9_BCL2A1-01       acccaag---------tctggctggctgacttttctggaagttacgggga
                                                                             

A0A452RHX5_MCL1-01         tggcttttgcaggtgttgctggagtaggagctg-----------------
A0A452SDS4_BCL2L1-01       cgctggttcctgacaggcatgactgtgg------------ctggcgtggt
A0A452SHI1_BCL2L2-01       gcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggt
A0A452R110_BCL2-01         ctgtctctgaaggccctgctcagtctggccctgg---tgggagcttgcat
A0A452R110_BCL2-02         --------------------------------------------------
A0A452QJG0_BCL2L10-01      ag-gctcttctgtcctgcttcacaggca------------gtgatcttaa
A0A452SIR9_BCL2A1-01       agatctgtgaaatgttctctctcctgaa----------------------
                                                                             

A0A452RHX5_MCL1-01         --------gtttggcata-tctaataagatag
A0A452SDS4_BCL2L1-01       tct-gctgggctcgctcttcagtcggaaatga
A0A452SHI1_BCL2L2-01       aac-tgtaggggccttttttgctagcaagtga
A0A452R110_BCL2-01         cac-cctgggtgcctacctgggccacaagtga
A0A452R110_BCL2-02         ---------------------------actaa
A0A452QJG0_BCL2L10-01      tctacttctggaaaagattatgtgagttctga
A0A452SIR9_BCL2A1-01       -------------------gcaatactactga
                                                        *  

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice