Dataset for CDS BCL-2-like of organism Ursus americanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A452SIR9_BCL2A1-      at--------------------------------------------gaca
A0A452SDS4_BCL2L1-      at------------------------------------------------
A0A452R110_BCL2-01      at--------------------------------------------gccg
A0A452R110_BCL2-02      at--------------------------------------------gccg
A0A452SHI1_BCL2L2-      at------------------------------------------------
A0A452QJG0_BCL2L10      at------------------------------------------------
A0A452RHX5_MCL1-01      atgtttggcctgaagagaaacgcagtaatcggactcaacctctactgtgg

A0A452SIR9_BCL2A1-      gactgtgagttcgggtacaccctgacgc----------------------
A0A452SDS4_BCL2L1-      --------gtctcagagcaaccgggagctggtggttgactttctctccta
A0A452R110_BCL2-01      gagacgcgggcgccgcgcccccgggggc----------------------
A0A452R110_BCL2-02      gagacgcgggcgccgcgcccccgggggc----------------------
A0A452SHI1_BCL2L2-      -------------ggcgaccccagcctc----------------------
A0A452QJG0_BCL2L10      ggcggacgcgctgagggagcgca----c----------------------
A0A452RHX5_MCL1-01      gggggccgggttgggggccggcagcggc----------------------
                                      *      *     *                      

A0A452SIR9_BCL2A1-      --tggcccaggactacgtg------aagcacgtcctgca-----------
A0A452SDS4_BCL2L1-      caagctttcccagaaaggatacagctggagtcagtttagtgatgtggaag
A0A452R110_BCL2-01      --cgcccccgcgcc-----------gggcatcttctcc------------
A0A452R110_BCL2-02      --cgcccccgcgcc-----------gggcatcttctcc------------
A0A452SHI1_BCL2L2-      --agccccagacacacgggctctagtggcagactttg-------------
A0A452QJG0_BCL2L10      --ggc----------------------gcggctgctgac-----------
A0A452RHX5_MCL1-01      --ggcgccgcctcatcggg-----agggcggcttttggcttcggggaag-
                           *                       *       *              

A0A452SIR9_BCL2A1-      -----------gatcccgcagccgggctcagccccgagcagggcgtccca
A0A452SDS4_BCL2L1-      agaacagaactgaggccccagaaggaactgaatcagagatggagaccccc
A0A452R110_BCL2-01      ---------------tcccagcctgg--------------------gctc
A0A452R110_BCL2-02      ---------------tcccagcctgg--------------------gctc
A0A452SHI1_BCL2L2-      -----------taggctataagctga---------ggcagaaaggttatg
A0A452QJG0_BCL2L10      ---------------cgactacctgg------------------------
A0A452RHX5_MCL1-01      -----------gaggccacggcccggcgggaggtagggggaggggaagcc

A0A452SIR9_BCL2A1-      ggtgc--------------------tgcg----------ggacgt-----
A0A452SDS4_BCL2L1-      agtgccatcaatggcaacccatcctggcacttggc----ggacagccctg
A0A452R110_BCL2-01      acccc--------------------cgcgcccgcc---aggacctcgccg
A0A452R110_BCL2-02      acccc--------------------cgcgcccgcc---aggacctcgccg
A0A452SHI1_BCL2L2-      tgtgt--------------------ggagctggccctggggagggcccag
A0A452QJG0_BCL2L10      agtac--------------------tgcgcc---c----gggagc-ccgg
A0A452RHX5_MCL1-01      ggtgc--------------------ggtgattggc----ggaagcgccgg
                                                  *            **         

A0A452SIR9_BCL2A1-      ------------ggcctcct-ccgtgcagggggaggtggaaaagaacttg
A0A452SDS4_BCL2L1-      cggtgaa--tggagccactggccacagcagcagct-tggatgcccgggag
A0A452R110_BCL2-01      cttaccgcccccggccgccc-ccgccgccgccgccgccgccgcgggccct
A0A452R110_BCL2-02      cttaccgcccccggccgccc-ccgccgccgccgccgccgccgcgggccct
A0A452SHI1_BCL2L2-      cagctgacccactgcaccaagccatgcgggcagc--tggagatgagtttg
A0A452QJG0_BCL2L10      cacccctgcgcgggcgccgt-ccacgcccgaggccgcggtgctgcgctcg
A0A452RHX5_MCL1-01      cgctagtcccccggccactc-tcgcgccggacgcc-cggagggtcgcgcg
                                     **  *    *      *  *     *           

A0A452SIR9_BCL2A1-      aaaccatgcc----------------------------------------
A0A452SDS4_BCL2L1-      gtgatc--cccatggcagcagtgaagcaagcg----ctgagggaggccgg
A0A452R110_BCL2-01      gcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccgg
A0A452R110_BCL2-02      gcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccgg
A0A452SHI1_BCL2L2-      agaccc-gcttc------------------cg------gcg---------
A0A452QJG0_BCL2L10      gtggcc-gccca-----------ggtccagca------gcgtca------
A0A452RHX5_MCL1-01      gccctc-gcccattggcgccgagggtcc--cg------acgtca------

A0A452SIR9_BCL2A1-      tggacagtttcgatgtggtgtccg------------------------tc
A0A452SDS4_BCL2L1-      ggatgagttcgaactgaggtaccggcgggcattcagcgacctgacatccc
A0A452R110_BCL2-01      cgatgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagcc
A0A452R110_BCL2-02      cgatgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagcc
A0A452SHI1_BCL2L2-      ------caccttctctgatt-tggcagc--------------------cc
A0A452QJG0_BCL2L10      cgagcacttcttgtccgattaccgcggctacgg-----------c--ggc
A0A452RHX5_MCL1-01      cggcgaccccc----------ccgaggctactgttcctcgagccc--acc
                                               *                         *

A0A452SIR9_BCL2A1-      gactccg-ccagaacc---------------atattcaatca--------
A0A452SDS4_BCL2L1-      agcttca--catcacccc-------------agggacagcg-----tatc
A0A452R110_BCL2-01      agctgcacctgacacccttcaccgcaaggggacgctttgccac-------
A0A452R110_BCL2-02      agctgcacctgacacccttcaccgcaaggggacgctttgccac-------
A0A452SHI1_BCL2L2-      agctgca--tgtgacccc-------------aggctcagcc-----cagc
A0A452QJG0_BCL2L10      aaccgcg--tg------------gagctgg-tggctcag-----------
A0A452RHX5_MCL1-01      cgccgcg--cgtcgccgcctgaagagatggaaggcccagccgccgacgcc
                          *  *                                            

A0A452SIR9_BCL2A1-      ----------------------------ggtcatggaaaaggaatttgaa
A0A452SDS4_BCL2L1-      agagctttgagca---------------ggtagtgaatgaactcttccgg
A0A452R110_BCL2-01      ----------------------------ggtggtggaggagctcttcagg
A0A452R110_BCL2-02      ----------------------------ggtggtggaggagctcttcagg
A0A452SHI1_BCL2L2-      aacgcttcaccca---------------ggtctctgacgaactcttccaa
A0A452QJG0_BCL2L10      ---------------gtggagcggga--gatactcgcccacccc------
A0A452RHX5_MCL1-01      atcatgtcgcccgaagaggagctggacgggtacgagccggaacctttggg
                                                    * *                   

A0A452SIR9_BCL2A1-      gacggca-----------tcattaactggggaaga------------att
A0A452SDS4_BCL2L1-      gatgggg--------------tgaactggggtcgc------------att
A0A452R110_BCL2-01      gatgggg--------------tgaactgggggagg------------att
A0A452R110_BCL2-02      gatgggg--------------tgaactgggggagg------------att
A0A452SHI1_BCL2L2-      gggg--------------gccccaactggggccgc------------ctg
A0A452QJG0_BCL2L10      ----cagcc----------cctaagctggggccgt------------gtg
A0A452RHX5_MCL1-01      gaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcg
                                                 **** *  *                

A0A452SIR9_BCL2A1-      gtgac-------------catatttgcgttcgaagggattct--------
A0A452SDS4_BCL2L1-      gtggc-------------ctttttctccttcggtggggcatt--------
A0A452R110_BCL2-01      gtggc-------------cttctttgagttcggtggggtcat--------
A0A452R110_BCL2-02      gtggc-------------cttctttgagttcggtggggtcat--------
A0A452SHI1_BCL2L2-      gtggc-------------cttctttgtctttggagccgcact--------
A0A452QJG0_BCL2L10      gtggc-------------gctcctcaccttcgcgggcacact--------
A0A452RHX5_MCL1-01      gtggcccttgtacggacggctcactgccctcgacgccacccccagcagag
                        *** *               *        * *  *               

A0A452SIR9_BCL2A1-      ------------------caccaagaaactc-------------------
A0A452SDS4_BCL2L1-      ---------------gtgcgtggagagc----------------------
A0A452R110_BCL2-01      ---------------gtgtgtggagagc----------------------
A0A452R110_BCL2-02      ---------------gtgtgtggagagc----------------------
A0A452SHI1_BCL2L2-      ---------------gtgtgctgagagt----------------------
A0A452QJG0_BCL2L10      --------------gctggagagatcgccgtcggggacctactc---gaa
A0A452RHX5_MCL1-01      gaggaggaagacgagttgtaccggcagtcgctggagattatctctcggta

A0A452SIR9_BCL2A1-      ----------------------ctccaggagcgaatctccccgga-----
A0A452SDS4_BCL2L1-      ----------------------gtagacaaggaga---------------
A0A452R110_BCL2-01      ----------------------gtcaaccgggaga---------------
A0A452R110_BCL2-02      ----------------------gtcaaccgggaga---------------
A0A452SHI1_BCL2L2-      ----------------------gtcaacaaagaga---------------
A0A452QJG0_BCL2L10      cct---ggggccgg--------accaggaactgga----gctggg-----
A0A452RHX5_MCL1-01      ccttcgggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggt

A0A452SIR9_BCL2A1-      -tgtgg-------------------------acgcttctaggat------
A0A452SDS4_BCL2L1-      -tgcag-------------------------gtattggtgagtc------
A0A452R110_BCL2-01      -tgtcg-------------------------cccctggtggaca------
A0A452R110_BCL2-02      -tgtcg-------------------------cccctggtggaca------
A0A452SHI1_BCL2L2-      -tggag-------------------------ccacttgtgggac------
A0A452QJG0_BCL2L10      --ggagcgggaggccgg--------------cgtccgccaggac------
A0A452RHX5_MCL1-01      ctggggcggccagccggaaggcgttagagaccctccgacgggtcggggac
                          *  *                                            

A0A452SIR9_BCL2A1-      --------ttcttacttcg--tggcagagttca----------tcacgac
A0A452SDS4_BCL2L1-      -----ggatcgcaact-tggatggccacttacc------tgaacgaccac
A0A452R110_BCL2-01      -----acattgcc-ctgtggatgactgagtacc------tgaaccggcac
A0A452R110_BCL2-02      -----acattgcc-ctgtggatgactgagtacc------tgaaccggcac
A0A452SHI1_BCL2L2-      ------aagtgcaagagtggatggtggcctacc----------tggagac
A0A452QJG0_BCL2L10      ---------tgccggcacc--tggtggacttcc----------tctgcaa
A0A452RHX5_MCL1-01      ggggtacagcgcaaccacg--agacggccttccaaggcatgcttcggaaa
                                              *      * *                * 

A0A452SIR9_BCL2A1-      aaacatgag------------------------------agagtggataa
A0A452SDS4_BCL2L1-      ctagagcct----------------------------------tggatcc
A0A452R110_BCL2-01      ctgcacacc----------------------------------tggatcc
A0A452R110_BCL2-02      ctgcacacc----------------------------------tggatcc
A0A452SHI1_BCL2L2-      acggctggc------------------------------tgactggatcc
A0A452QJG0_BCL2L10      tcggctcac-------gggacagcatcgcgcct-------ggctggaggc
A0A452RHX5_MCL1-01      ctggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggt

A0A452SIR9_BCL2A1-      ggc-----agaacggagg---------ctgggaag-----atggcttt--
A0A452SDS4_BCL2L1-      agg-----agaacggcgg---------ctgggacactttcgtggaact--
A0A452R110_BCL2-01      agg-----acaacggagg---------ctgggatgcctttgtggagttg-
A0A452R110_BCL2-02      agg-----acaacggagg---------ctggg------------------
A0A452SHI1_BCL2L2-      aca-----gcagtggggg---------ctgggcggagttcacagctct--
A0A452QJG0_BCL2L10      gca---------cgacgg---------ctgggtga-----atggcttttg
A0A452RHX5_MCL1-01      ccatgttttcagtgacggagtaacaaactggggcaggattgtgactctta
                                     *  **         *****                  

A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      -------------ctacgggaacaa-------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A452SHI1_BCL2L2-      -------------atacggggacggggccctggaggagg-----------
A0A452QJG0_BCL2L10      tctcttct-------------tcacacccatg------------------
A0A452RHX5_MCL1-01      tttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaa

A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      --------tgcagcggctg-------------------------------
A0A452R110_BCL2-01      --------tacggccccagcatgc--------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------cgcggcgtctgcgggagg------------------------
A0A452QJG0_BCL2L10      --------ctggccgtccg-------------------tcttggaa----
A0A452RHX5_MCL1-01      agctgcatcgaaccattagcagaaagcatcacagatgttctcgtaaggac

A0A452SIR9_BCL2A1-      -------------------gtaaagaagttcgaacccaagt---------
A0A452SDS4_BCL2L1-      -----aaagccggaagggccaggagcgcttcaaccgctggt--------t
A0A452R110_BCL2-01      --------------------------------agcctctgtttgacttct
A0A452R110_BCL2-02      --------------------------------------------------
A0A452SHI1_BCL2L2-      -----ggaactg--------------------ggcctcagtgaggacagt
A0A452QJG0_BCL2L10      -----aagact------------------gctggcccaggctc------t
A0A452RHX5_MCL1-01      aaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagt

A0A452SIR9_BCL2A1-      -ctggctggctgacttttctggaagttacgg------------ggaagat
A0A452SDS4_BCL2L1-      cctgacagg-----------------------------------------
A0A452R110_BCL2-01      cctggctgt------------------------------ctctgaaggcc
A0A452R110_BCL2-02      --------------------------------------------------
A0A452SHI1_BCL2L2-      gctgacagg--------------ggccgtggc--------actgggggcc
A0A452QJG0_BCL2L10      tctgtcctg-------cttcacaggcagtgatcttaatctacttctgg--
A0A452RHX5_MCL1-01      tcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggct

A0A452SIR9_BCL2A1-      ctgtgaaatgttctctctcctgaagc------aatactactga-------
A0A452SDS4_BCL2L1-      --------------catgactgtggctggcgtggttctgctgggctcgct
A0A452R110_BCL2-01      ctgctcagtctggccctggtgggagcttgcatcacc---ctgggtgccta
A0A452R110_BCL2-02      --------------------------------caca---ctaa-------
A0A452SHI1_BCL2L2-      ctggtaactgt---------aggggccttttttg-----ctag-------
A0A452QJG0_BCL2L10      --------------------aaaagattatgtg--agttctga-------
A0A452RHX5_MCL1-01      tttgcaggtgttgctggagtaggagctggtttggcatatctaa-------

A0A452SIR9_BCL2A1-      -----------------
A0A452SDS4_BCL2L1-      cttcagtcggaaatga-
A0A452R110_BCL2-01      cctgggccacaagtga-
A0A452R110_BCL2-02      -----------------
A0A452SHI1_BCL2L2-      ---------caagtga-
A0A452QJG0_BCL2L10      -----------------
A0A452RHX5_MCL1-01      ---------taagatag

© 1998-2020Legal notice