Dataset for CDS BCL2L1 of organism Ictalurus punctatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5U9J4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ictalurus punctatus GN=BCL2L1 (length=729 residues).
atgtcttactacaacagagaactggtggtgtacttcatcaagtacaagctctcgcagagaaactacccctgcaatcatat
cgggctcacagaagatgtgaacggaaccgaaggaggccaggcagaggaagcgagcgctgagggagcggcagaattggaaa
cgccgacagctgtcgttaacggcgccgtaaacggaacgggttcagcagggactcctccgcaatcgccgactttgtcccct
cggaggcaggtgaacggcggcgcgagtctggaggcagtaaaggaggcgctgcgtgactcggccaacgagttcgagctgcg
ctatgctcgcgcctttagcgacctgtcgtcgcagttgcatatcactccggtcacggtgtaccagagctttgagagcgtga
tggacgaggtgttccgtgatggtgtcaactggggccgcatcgtgggcttgttcgccttcgggggtgccctctgcgtcgag
tgcgtggaaaaggagatgagtccgctggtggcgcgtatcgccgagtggatgaccgtgtacctggacaaccacatccagcc
ctggatccaagagcaaggaggatgggagcgttttgcagagatcttcgggaaagacgcagcagcggagagcagaaggtcac
aggaaagcttcaagaagtggctgctggcagggatgacgttgttcacaggggtggtgttgggctccttcatcgctcagaag
cgcctgtaa
© 1998-2020Legal notice