Dataset for CDS BCL-2-like of organism Accipiter nisus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9RZD1_BCL2A1-      atg-------------gaaactgctgagttctattacgtttattacttgg
A0A8B9N2I0_BCL2L1-      atg-----tccagcagtaatcgg-------------gagttagtgattga
A0A8B9RWH9_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
A0A8B9M984_MCL1-01      atg-----ttcgccgtgaagcgg------------------aacgccg--
A0A8B9M984_MCL1-02      atg-----ttcgccgtgaagcgg------------------aacgccg--
                        ***              **   *                  *        

A0A8B9RZD1_BCL2A1-      ctcaagattatctgcaatatgtgcttcag--gaatcacatcttggac---
A0A8B9N2I0_BCL2L1-      cttt--gtttcctacaagctct--cacagaagggatacagctggagt---
A0A8B9RWH9_BCL2-01      gtac--atccactataaactct--cgcagaggggatacgactgggctgc-
A0A8B9M984_MCL1-01      --tc--atcggcttcaacctctactgcggcggcggcccggccctggcgcc
A0A8B9M984_MCL1-02      --tc--atcggcttcaacctctactgcggcggcggcccggccctggcgcc
                               *   **  **  * *    * *  *     *  *         

A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      -----cagctggaggagga-------------------------------
A0A8B9RWH9_BCL2-01      -----cgccgaggacaggg-cacccctgcctccgggtctctctcctcctg
A0A8B9M984_MCL1-01      cgcctcgccgggaggggggccggccccgccgccg------------ccgc
A0A8B9M984_MCL1-02      cgcctcgccgggaggggggccggccccgccgccg------------ccgc
                                                                          

A0A8B9RZD1_BCL2A1-      ------------------cagcccaaaccagggttgctcatgt-------
A0A8B9N2I0_BCL2L1-      -------------------ggatgagaacaggactgactttgcagcagag
A0A8B9RWH9_BCL2-01      ctgctgctgctgctgcggttgctgctgctgctgctgctgctgctgctgct
A0A8B9M984_MCL1-01      ccgccgccgccgctgaggtacccgggaccctgattggctccgtggcggcc
A0A8B9M984_MCL1-02      ccgccgccgccgctgaggtacccgggaccctgattggctccgtggcggcc
                                                          **     *        

A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      gaggccga---------------------------gatg---------ga
A0A8B9RWH9_BCL2-01      gggacttcctctgatcacactgg------------gctggt-------gt
A0A8B9M984_MCL1-01      tgggccgccgccggtcgccccgagcacccccgcgcgctggttggctgcgg
A0A8B9M984_MCL1-02      tgggccgccgccggtcgccccgagcacccccgcgcgctggttggctgcgg
                                                                          

A0A8B9RZD1_BCL2A1-      --------cttgcgaaacattgcatcttc---------------------
A0A8B9N2I0_BCL2L1-      cggcgtcctcaatg----ggagcccctcctggcac---------------
A0A8B9RWH9_BCL2-01      ctccgcaccccgag----------ccccccggctcggcc-----------
A0A8B9M984_MCL1-01      cgcggccccccgcgcggcgctgccccccgcggcgcggccgggcgcgctgt
A0A8B9M984_MCL1-02      cgcggccccccgcgcggcgctgccccccgcggcgcggccgggcgcgctgt
                                     *           *                        

A0A8B9RZD1_BCL2A1-      ------------------------gctgcaag----------------at
A0A8B9N2I0_BCL2L1-      ---------------------ccgcctgccagccacgtagtgaac-----
A0A8B9RWH9_BCL2-01      ------------------------gctgctagccacgcgcc--------c
A0A8B9M984_MCL1-01      ggagccccgaggaggagctggacggctgcgagccggaggccgagcgcggc
A0A8B9M984_MCL1-02      ggagccccgaggaggagctggacggctgcgagccggaggccgagcgcggc
                                                 **** **                  

A0A8B9RZD1_BCL2A1-      caaaccgagga---------------------ggctctcagaccatt---
A0A8B9N2I0_BCL2L1-      --------gga---gccgccatgcaccggagcagccttgaagtccatgaa
A0A8B9RWH9_BCL2-01      ccggccgaggg---gctgccccccgc----gc--ccc--aggtcgtccac
A0A8B9M984_MCL1-01      ccggcgggggactcgctgcccggcac----gccgccc--gggccgccgga
A0A8B9M984_MCL1-02      ccggcgggggactcgctgcccggcac----gccgccc--gggccgccgga
                                **                        *        *      

A0A8B9RZD1_BCL2A1-      -------------cttggacaggattgatat-tacttctgtagctgtggc
A0A8B9N2I0_BCL2L1-      atcgttcaaacagctgatgtaaggcaggcgt-------------------
A0A8B9RWH9_BCL2-01      ctcgcc-------ctgcgccagg-cgggcgacgagttctcccgccgctac
A0A8B9M984_MCL1-01      gccgcccgatgggctgcggcaggactcgctg-gagctcatcagccgctac
A0A8B9M984_MCL1-02      gccgcccgatgggctgcggcaggactcgctg-gagctcatcagccgctac
                                     **     * *                           

A0A8B9RZD1_BCL2A1-      caagagaa------------------------------------------
A0A8B9N2I0_BCL2L1-      -tgagagaggcaggggatgagtttgagttga-------------------
A0A8B9RWH9_BCL2-01      cagaggga----------------------------------cttcgccc
A0A8B9M984_MCL1-01      ctgcgggaggcggcgggcgaggccgagcccgccgtgaagaagctttttcc
A0A8B9M984_MCL1-02      ctgcgggaggcggcgggcgaggccgagcccgccgtgaagaagctttttcc
                               *                                          

A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      -------------ggtaccggcgggctt----------------------
A0A8B9RWH9_BCL2-01      aa-----------atgtccggccagct-----------------------
A0A8B9M984_MCL1-01      ggggctgctgggcgggcccggccggcccgggggatcgggcgatgccgtga
A0A8B9M984_MCL1-02      ggggctgctgggcgggcccggccggcccgggggatcgggcgatgccgtga
                                                                          

A0A8B9RZD1_BCL2A1-      -------------------ttttc-----------aatggtgtc------
A0A8B9N2I0_BCL2L1-      --------tcagcgacctcacttc------------ccagctccacat--
A0A8B9RWH9_BCL2-01      --------gcacctgacgcccttc------------acgg----------
A0A8B9M984_MCL1-01      tggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgcag
A0A8B9M984_MCL1-02      tggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgcag
                                             * *               *          

A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      -------------cacccctggcacggcgtatcagagttttg--------
A0A8B9RWH9_BCL2-01      -----------------ccaggggc--cgcttcg-----tgg--------
A0A8B9M984_MCL1-01      aaacacgagctggccttccagggaa--tgcttcggaaactggaaatccag
A0A8B9M984_MCL1-02      aaacacgagctggccttccagggaa--tgcttcggaaactggaaatccag
                                                                          

A0A8B9RZD1_BCL2A1-      -------------------------atggaagaaa--------aatttgc
A0A8B9N2I0_BCL2L1-      ----------------agcaggta-gtgaatgaac--------tcttccg
A0A8B9RWH9_BCL2-01      -------------------cggtg-gtggaggagc--------tcttccg
A0A8B9M984_MCL1-01      aaagaggaagatctgcagtcggtgtgtgaagtggctgcccacgtgttcag
A0A8B9M984_MCL1-02      aaagaggaagatctgcagtcggtgtgtgaagtggctgcccacgtgttcag
                                                  ** *               **   

A0A8B9RZD1_BCL2A1-      tgatggaaatactaactggggacgaattatgaccatatttacctttgggg
A0A8B9N2I0_BCL2L1-      tgatggagt---gaactggggtcgcatcgtggctttcttctccttcggag
A0A8B9RWH9_BCL2-01      agacggcgt---caactggggcaggatcgtggccttcttcgagttcggcg
A0A8B9M984_MCL1-01      tgatggagtaacaaactggggtcgagtggtgacactcatctcgttcggtg
A0A8B9M984_MCL1-02      tgatggagtaacaaactggggtcgagtggtgacactcatctcgttcggtg
                         ** **       ********  *  *  ** *  *  *    ** ** *

A0A8B9RZD1_BCL2A1-      gtcttctcactaagaagcttcaagagcat------ggagt------tcag
A0A8B9N2I0_BCL2L1-      ga------gccttg-tgtgtggagagcgttgacaaggagatgcgggt---
A0A8B9RWH9_BCL2-01      gc------gtgatg-tgcgtggagagcgtcaaccgggaga--tgtctccc
A0A8B9M984_MCL1-01      cctttgttgcgaaa-cacctgaaaagcataaaccaggagaggtgcatcag
A0A8B9M984_MCL1-02      cctttgttgcgaaa-cacctgaaaagcataaaccaggagaggtgcatcag
                                           *  * *** *      ****       *   

A0A8B9RZD1_BCL2A1-      ctcactggagaagagaaggagcagatttcttatttcatcacagagt---a
A0A8B9N2I0_BCL2L1-      ---attgg--------tgggacgcgttgtatcttggatgaccacgt---a
A0A8B9RWH9_BCL2-01      ctcgtaga--------cag----catcgccgcctggatgaccgagt---a
A0A8B9M984_MCL1-01      ctcgctgg--------cagggatcatcac-----agatgcacttgtctca
A0A8B9M984_MCL1-02      ctcgctgg--------cagggatcatcac-----agatgcacttgtctca
                              *           *      *          **      **   *

A0A8B9RZD1_BCL2A1-      cataataaacaacaaagccgaatggatagatgcgaatggtggctggg---
A0A8B9N2I0_BCL2L1-      cttgaccgaccacctagatccctggatccaggagaatggcggatgggagc
A0A8B9RWH9_BCL2-01      cctgaaccggcacctgcacaactggatccaggacaacggaggctgggatg
A0A8B9M984_MCL1-01      tctaa----------gcgcgagtggctaatgagccagggaggctgggagg
A0A8B9M984_MCL1-02      tctaa----------gcgcgagtggctaatgagccagggaggctgggagg
                          * *                 *** *        * ** ** ****   

A0A8B9RZD1_BCL2A1-      -----------------------aaaatggcttcctaa----caaagttt
A0A8B9N2I0_BCL2L1-      ggtttgtggacctctatgggaacgatgctgctgccgag--------gtga
A0A8B9RWH9_BCL2-01      ccttcgtggagttgtatggcaacagtatgaggcctttg---------ttc
A0A8B9M984_MCL1-01      gctttgttgacttctttcg----agt-cgaggacctagaaggcagcatca
A0A8B9M984_MCL1-02      gctttgttgacttctttcg----agt-cgaggacctagaaggcagcatca
                                                         *             *  

A0A8B9RZD1_BCL2A1-      gaaa------gaagatcactactat-----ctttctccaaaatcacagcc
A0A8B9N2I0_BCL2L1-      ggaagggccaggagaccttcaacaa-----atggctcctgacc-ggggcg
A0A8B9RWH9_BCL2-01      gatttctcctggatctctctgaagactatcctgagtctggttctggtggg
A0A8B9M984_MCL1-01      gaaatgtactgatggcgtttgcagg------tgtggctggactaggagcg
A0A8B9M984_MCL1-02      gaaatgtactgatggcgtttgcagg------tgtggctggactaggagcg
                        *         *                    *    *          *  

A0A8B9RZD1_BCL2A1-      atgtt---------------------------------------------
A0A8B9N2I0_BCL2L1-      acggtggcaggagtgcttc-------------------------------
A0A8B9RWH9_BCL2-01      agcttg-----catcactc-------------------------------
A0A8B9M984_MCL1-01      agcttggcctacatgatccggaatgtcaccaactgctggatccctagcct
A0A8B9M984_MCL1-02      agcttggcctacatgatcc-------------------------------
                        *   *                                             

A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A8B9M984_MCL1-01      gggatggcagggaacagagttctgctcctcctgggatggctcatgtccaa
A0A8B9M984_MCL1-02      --gattgcaggta-------------------------------------
                                                                          

A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A8B9M984_MCL1-01      ggccagcattgcttctttctatgccagggacactgcaggagacctggcag
A0A8B9M984_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9RZD1_BCL2A1-      --------catagctgttttttcct-------------------------
A0A8B9N2I0_BCL2L1-      --------tgctgggatccctgc---------------------------
A0A8B9RWH9_BCL2-01      ----------ttggcgcttatct---------------------------
A0A8B9M984_MCL1-01      gcacatcccaggagtgctcattccttcttcctttcctcctctcagctcaa
A0A8B9M984_MCL1-02      ------ccaatgaggatttattgctt------------------------
                                            *                             

A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A8B9M984_MCL1-01      gcccttgtccttgctggtgagtctctgcttgcagagttatggtgacagtc
A0A8B9M984_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A8B9M984_MCL1-01      cttggggtcctgaacagttcttgctgaacaaggcaacaggccttggtgtc
A0A8B9M984_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A8B9M984_MCL1-01      ccctcaagcagcagcaagtcatgttgcgactctgctgtccttccatgtgc
A0A8B9M984_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9RZD1_BCL2A1-      -----------------------------tgctca---------------
A0A8B9N2I0_BCL2L1-      -----------------------------tgagcc---------------
A0A8B9RWH9_BCL2-01      -----------------------------tggaca---------------
A0A8B9M984_MCL1-01      tgcctggctcaaaaggtgtccggcagcactgggcaccaggtgcaagccct
A0A8B9M984_MCL1-02      -----------------------------tgggaa---------------
                                                     **                   

A0A8B9RZD1_BCL2A1-      -------------gagagtac-----------------------------
A0A8B9N2I0_BCL2L1-      -------------gcaagtga-----------------------------
A0A8B9RWH9_BCL2-01      --------------taagtag-----------------------------
A0A8B9M984_MCL1-01      gccacccctctgaaagattagacagtctccccaaatcccaccagtgccct
A0A8B9M984_MCL1-02      -----------gagaaagtgga----------------------------
                                        * *                               

A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A8B9M984_MCL1-01      agaaaccccagtgagcactggggttctgccctcttccccccttccagagt
A0A8B9M984_MCL1-02      --------------------------------------------------
                                                                          

A0A8B9RZD1_BCL2A1-      ----------tactga
A0A8B9N2I0_BCL2L1-      ----------------
A0A8B9RWH9_BCL2-01      ----------------
A0A8B9M984_MCL1-01      ccatgctcagggttgg
A0A8B9M984_MCL1-02      --------agaattga
                                        

© 1998-2022Legal notice