Dataset for CDS BCL-2-like of organism Sinocyclocheilus rhinocerous

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A673LV42_BCL2-01      at------------------ggcacaggagaatgtgtatgataaccggag
A0A673HVU7_BCL2-01      at------------------ggccaccgaaattcgctttgacaatcggaa
A0A673M4N6_BCL2L1-      at------------------gtc---------ttactatcac---caaga
A0A673IGS5_BCL2L1-      at------------------gtc---------ttactatcac---caaga
A0A673M4N6_BCL2L1-      at------------------gtc---------ttactatcac---caaga
A0A673IXK8_MCL1-01      at------------------------------------------------
A0A673MXF5_MCL1-01      at------------------------------------------------
A0A673HSI2_MCL1-01      at------------------------------------------------
A0A673GSK0_MCL1-03      ct------------------------------------------------
A0A673GSK0_MCL1-01      atgctgaaaatacagctgcgcatcacagaaataaattacagtttaacaga
A0A673GSK0_MCL1-02      at------------------------------------------------

A0A673LV42_BCL2-01      catagtggtgaagtacatccaccataagctctggaag-------------
A0A673HVU7_BCL2-01      tattgtggagaaatacatcaatcacaaactttcaaag-------------
A0A673M4N6_BCL2L1-      actggtggtattttttattaaatataaactctcacag-------------
A0A673IGS5_BCL2L1-      actggtggtattttttattaaatataaactctcgcag-------------
A0A673M4N6_BCL2L1-      actggtggtattttttattaaatataaactctcacag-------------
A0A673IXK8_MCL1-01      ------------gttccctgggagtaaagttttaaac-------------
A0A673MXF5_MCL1-01      ------------gttccctgggagtaaagtttcaaac-------------
A0A673HSI2_MCL1-01      -------------gactctgagtttggggaatagacc-------------
A0A673GSK0_MCL1-03      ------------aagctttaaccttcgacgttcagac-------------
A0A673GSK0_MCL1-01      tattcacatagaaaacagttattttaaatatttagtcagaagaacggctg
A0A673GSK0_MCL1-02      --------------------------------------------------

A0A673LV42_BCL2-01      --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673IGS5_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      cggtcagtctgctcggcgcgcacacggcgctcgtgcccgcgcccgcactc
A0A673GSK0_MCL1-02      --------------------------------------------------

A0A673LV42_BCL2-01      ---------------aagggatacgtgtggga----agtgaacggaca--
A0A673HVU7_BCL2-01      ---------------aagggat-------------------atgtgtgga
A0A673M4N6_BCL2L1-      ---------------aggaactacccctacaatcacattgaatttacaga
A0A673IGS5_BCL2L1-      ---------------aggaactacccctacaaccacattgaatttacaga
A0A673M4N6_BCL2L1-      ---------------aggaactacccctacaatcacattgaatttacaga
A0A673IXK8_MCL1-01      ---------------gacaaaggcttttggccatgcattggaataacagc
A0A673MXF5_MCL1-01      ---------------gacagcggcttttggccatgcattggaatagcagc
A0A673HSI2_MCL1-01      ---------------gatggctgcgttgggtgtcctcgcggatgagacgg
A0A673GSK0_MCL1-03      ------cgactcgaagacgagctcgacgggtg----cgcggatgaaccgg
A0A673GSK0_MCL1-01      aaaccgcggagcgaggacgagctcgacgggtg----cgcggatgaaccgg
A0A673GSK0_MCL1-02      --------------------------------------------------

A0A673LV42_BCL2-01      ------cgatgacagcgtctcgaatgga-ctgatgatggagaggcgggag
A0A673HVU7_BCL2-01      aatctcaa-----------tcttctggggaggatgatgacaccgccaata
A0A673M4N6_BCL2L1-      agacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcag
A0A673IGS5_BCL2L1-      agacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcag
A0A673M4N6_BCL2L1-      agacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcag
A0A673IXK8_MCL1-01      tcttaacgtcaacagcagctcgggcgggcttggtcgcaagccactggtaa
A0A673MXF5_MCL1-01      tcttaacgtcaacaacagctcgagcgggtttggtcgcaagccacttgtaa
A0A673HSI2_MCL1-01      acgccgcgctgaagccgctgaggcccgg------gacgaacggcctgaaa
A0A673GSK0_MCL1-03      acgccgcggtgaagccggtaagaccggg------aaccaacggcctgaag
A0A673GSK0_MCL1-01      acgccgcggtgaagccggtaagaccggg------aaccaacggcctgaag
A0A673GSK0_MCL1-02      ----------------------accggg------aaccaacggcctgaag

A0A673LV42_BCL2-01      -------gacggcggcatctctcccag-----------------------
A0A673HVU7_BCL2-01      ---aaggaatcgagggttcctctctaaactctggcaggaggcttcagg--
A0A673M4N6_BCL2L1-      ---caggaac--aacgaccctcgttaa------------------tgg--
A0A673IGS5_BCL2L1-      ---caggaac--aacgaccctcgttaa------------------tgg--
A0A673M4N6_BCL2L1-      ---caggaac--aacgaccctcgttaa------------------tgg--
A0A673IXK8_MCL1-01      tgccag-aactgaaaccccagaaccagtttacagggaacggactccaggg
A0A673MXF5_MCL1-01      tgccag-aactgaaagcccagaaccagttcacagggaacggtctccaggg
A0A673HSI2_MCL1-01      ggactgcagctggacggacggttcgtgtccgcgggagacggctctc----
A0A673GSK0_MCL1-03      ggactgcaactggacggacgcttcgtttgcgcggcggacggatctc----
A0A673GSK0_MCL1-01      ggactgcaactggacggacgcttcgtttgcgcggcggacggatctc----
A0A673GSK0_MCL1-02      ggactgcaactggacggacgcttcgtttgcgcggcggacggatctc----

A0A673LV42_BCL2-01      --------------ctcccgtcacgacccgtgcagggct-----------
A0A673HVU7_BCL2-01      ------------ctccctcagccggaggggggaacaact-----------
A0A673M4N6_BCL2L1-      ------------ctccctaaac--------ggaacaagt-----------
A0A673IGS5_BCL2L1-      ------------ctccctaaac--------ggaacaagt-----------
A0A673M4N6_BCL2L1-      ------------ctccctaaac--------ggaacaagt-----------
A0A673IXK8_MCL1-01      ctcggtaccatcctcgcctgagccggattgcgaggaagtacaagatgaat
A0A673MXF5_MCL1-01      ctcggtaccatcctcgcctgagacggactgcgaggaaat---agatgatt
A0A673HSI2_MCL1-01      -----taccggccaccccggacccg------caggagct-----------
A0A673GSK0_MCL1-03      -----taccgaacacaccggacccg------caggagtt-----------
A0A673GSK0_MCL1-01      -----taccgaacacaccggacccg------caggagtt-----------
A0A673GSK0_MCL1-02      -----taccgaacacaccggacccg------caggagtt-----------
                                      * *                     *           

A0A673LV42_BCL2-01      ---------------cttcataaggtgctctcccgtcacgacccgtgcag
A0A673HVU7_BCL2-01      -----------ctgaatgc-ctgatagctcac-c-gggtcactcgttcag
A0A673M4N6_BCL2L1-      ----------actggttccactgggaccccac-caaggtcccccgcttca
A0A673IGS5_BCL2L1-      ----------actggttccactgggaccccac-caaggtcccccgcttca
A0A673M4N6_BCL2L1-      ----------actggttccactgggaccccac-caaggtcccccgcttca
A0A673IXK8_MCL1-01      acacgtccatctatgacgctctggaaatggacacacgagagattattgac
A0A673MXF5_MCL1-01      acacctccatctacgccgccctggaaatggacacgcgagagattattgac
A0A673HSI2_MCL1-01      -------cggttc---------------cgacacgcagcagcttctgttg
A0A673GSK0_MCL1-03      -------cggttccgccgaactggatcgcgacacgagacagctcttgttg
A0A673GSK0_MCL1-01      -------cggttccgccgaactggatcgcgacacgagacagctcttgttg
A0A673GSK0_MCL1-02      -------cggttccgccgaactggatcgcgacacgagacagctcttgttg
                                                       * *                

A0A673LV42_BCL2-01      ggctct-----tcata---------------------------------a
A0A673HVU7_BCL2-01      accc-------ttattcaa----------ggatct-----------accg
A0A673M4N6_BCL2L1-      accccccagcgtcagacgaacgggactgggggtctggatgcagtaaagga
A0A673IGS5_BCL2L1-      accccccagcgtcagacgaacgggactgggggtctggacgctgtaaagga
A0A673M4N6_BCL2L1-      accccccagcgtcagacgaacgggactgggggtctggatgcagtaaagga
A0A673IXK8_MCL1-01      attt-------tcttaaaaaactttactggattccctcattctaaaagtg
A0A673MXF5_MCL1-01      gctt-------tcttaaaaagctttacaggactccctcattctaaaagtg
A0A673HSI2_MCL1-01      gact-------tctatcgcacgcacaccggaatgagtctcccggatcgga
A0A673GSK0_MCL1-03      gatt-------tctaccgcacgcacaccggaatgtgtccgcaggaccgga
A0A673GSK0_MCL1-01      gatt-------tctaccgcacgcacaccggaatgtgtccgcaggaccgga
A0A673GSK0_MCL1-02      gatt-------tctaccgcacgcacaccggaatgtgtccgcaggaccgga

A0A673LV42_BCL2-01      ggtgctgcgggaggccggggatgaactggagcggctttatc---------
A0A673HVU7_BCL2-01      ggcgctacgcgaggctggagacgagatagaaaggctataccagcgt----
A0A673M4N6_BCL2L1-      ggcgcttcgcgattctgccaacgagtttgagctgcgttattcccaa----
A0A673IGS5_BCL2L1-      ggcgcttcgcgattctgccaacgagtttgagctgcgttattcccaa----
A0A673M4N6_BCL2L1-      ggcgcttcgcgattctgccaacgagtttgagctgcgttattcccaa----
A0A673IXK8_MCL1-01      ggaataaacaggttctggcaacga---tgaatcgggttgtggaaagtctt
A0A673MXF5_MCL1-01      gaaaaaaccaggttctgtctacga---tgaagcgggttgtggacagtctc
A0A673HSI2_MCL1-01      agcgtcatcacgcgttaccgacaa---tgaagcgcgtcgtcgcggacgtc
A0A673GSK0_MCL1-03      agcagcatcacgcgctaccgacaa---tgactcgcgttgtcgcggacgtt
A0A673GSK0_MCL1-01      agcagcatcacgcgctaccgacaa---tgactcgcgttgtcgcggacgtt
A0A673GSK0_MCL1-02      agcagcatcacgcgctaccgacaa---tgactcgcgttgtcgcggacgtt
                                            *  *    **   *                

A0A673LV42_BCL2-01      -------------agtcggactttgcggagatgtccaaacggctgcacc-
A0A673HVU7_BCL2-01      ------------------gaatttgaggagatgtc-ccaccgcatgatat
A0A673M4N6_BCL2L1-      ------------------gcattcaacgacctgtcgtcgcagctccaca-
A0A673IGS5_BCL2L1-      ------------------gcattcaacgacctgtcctcgcagctccaca-
A0A673M4N6_BCL2L1-      ------------------gcattcaacgacctgtcgtcgcagctccaca-
A0A673IXK8_MCL1-01      gtggtgaagcacgaactggcttacaaaggtatgattgcacgtctgaatc-
A0A673MXF5_MCL1-01      gcggtgaagcacgaactggcttacaaaggtatgattgcacggctgaatc-
A0A673HSI2_MCL1-01      ctcataaagcaccagatcacttacacagggatgctgcagcgtctgcagc-
A0A673GSK0_MCL1-03      ctcttaaagcacgagactacattcaaaggaatgttgcagcgtctacagc-
A0A673GSK0_MCL1-01      ctcttaaagcacgagactacattcaaaggaatgttgcagcgtctacagc-
A0A673GSK0_MCL1-02      ctcttaaagcacgagactacattcaaaggaatgttgcagcgtctacagc-
                                             *     *   **      *  *   *   

A0A673LV42_BCL2-01      tcacgtccatcacggcgcatcagcgct---tcaccgcggtcatagacgag
A0A673HVU7_BCL2-01      tcagtcccaatacaacgcaacgcagct---tcttagccgtggcagaagag
A0A673M4N6_BCL2L1-      tcacgcctgccacagcgtaccagagct---tcgagagcgtgatggatgag
A0A673IGS5_BCL2L1-      tcacgcctgccacggcgtaccagagct---tcgagagcgtgatggatgag
A0A673M4N6_BCL2L1-      tcacgcctgccacagcgtaccagagct---tcgagagcgtgatggatgag
A0A673IXK8_MCL1-01      tggagcagaaaggagaagatgtgagtttcgtcaagactgttgcaacagaa
A0A673MXF5_MCL1-01      tggagcagaaaggagaagatgtgagttttgtcaagactgtggcaacagaa
A0A673HSI2_MCL1-01      tggactctcagccggacgacttgagcgtcatcgactgtatagcaaagacg
A0A673GSK0_MCL1-03      tggaatctcaagcagacgacatgagcttcatcagctttatagcagagacg
A0A673GSK0_MCL1-01      tggaatctcaagcagacgacatgagcttcatcagctttatagcagagacg
A0A673GSK0_MCL1-02      tggaatctcaagcagacgacatgagcttcatcagctttatagcagagacg
                        *                 *     *     **       *          

A0A673LV42_BCL2-01      ctgttcggggacggcgtg---aactggggcagaatcatcgcttttttcga
A0A673HVU7_BCL2-01      ctctttaaagacggagtg---aactgggggcggatcatcgctttctttga
A0A673M4N6_BCL2L1-      gtgttccgcgacggcgtc---aactggggccgcatcgtgggactgtttgc
A0A673IGS5_BCL2L1-      gtgttccgcgacggcgtc---aactggggccgcatcgtgggactgtttgc
A0A673M4N6_BCL2L1-      gtgttccgcgacggcgtc---aactggggccgcatcgtgggactgtttgc
A0A673IXK8_MCL1-01      ctcttcagcgatggcatcacaaactggggtcgcattgccagcctgcttac
A0A673MXF5_MCL1-01      ctcttcagcgatggcatcacaaactgggggcgcatttgcagcctgctgac
A0A673HSI2_MCL1-01      atgttcagagacgacaccaccaactggggccggatcgtgagtctggtggc
A0A673GSK0_MCL1-03      atgttcagagacgacaccaccaactggggccggatcgtgagtctggtggc
A0A673GSK0_MCL1-01      atgttcagagacgacaccaccaactggggccggatcgtgagtctggtggc
A0A673GSK0_MCL1-02      atgttcagagacgacaccaccaactggggccggatcgtgagtctggtggc
                         * **    ** *        ********  * **        *  *   

A0A673LV42_BCL2-01      gtttggagggactgtttgtgtcgaatgcgtgaataaggagatgatggcgc
A0A673HVU7_BCL2-01      gtttggtgggaccatgtgtgtggagagcgtcaaccgggagatggcgtccc
A0A673M4N6_BCL2L1-      cttcggaggggctctgtgtgttgagtgcgtggagaaggagatgagcccgc
A0A673IGS5_BCL2L1-      ctttggaggggctctgtgtgttgagtgcgtggagaaggagatgagcccac
A0A673M4N6_BCL2L1-      cttcggaggggctctgtgtgttgagtgcgtggagaaggagatgagcccgc
A0A673IXK8_MCL1-01      tcttggggcaatggtatgcaagcatcagaatga----taaaggacttagc
A0A673MXF5_MCL1-01      ttttggggcactggtatgcaagcatcaaaatga----tagaggacttagc
A0A673HSI2_MCL1-01      cttcggggccgtggtgtgctcgcagctgaaggagctgcagaggg---agc
A0A673GSK0_MCL1-03      cttcggggctgtggtgtgctcgcgtctgaaagagctgcagaggg---agc
A0A673GSK0_MCL1-01      cttcggggctgtggtgtgctcgcgtctgaaagagctgcagaggg---agc
A0A673GSK0_MCL1-02      cttcggggctgtggtgtgctcgcgtctgaaagagctgcagaggg---agc
                          * ** *      * **              *     * * *      *

A0A673LV42_BCL2-01      atgt----ggataacattgcgggctggatgaccgagtatctgaacgggcc
A0A673HVU7_BCL2-01      aggt----agataatattgcacactggatgacagactacctgaacgggcc
A0A673M4N6_BCL2L1-      tagt----gggaagcatcgcggattggatgaccgtctacctagacaacaa
A0A673IGS5_BCL2L1-      tagt----gggaagcatcgcggaatggatgaccgtctacctagacaacaa
A0A673M4N6_BCL2L1-      tagt----gggaagcatcgcggattggatgaccgtctacctagacaacaa
A0A673IXK8_MCL1-01      aagtgtgcgagtctggtggggaaagagatctcttcctatcttctcataac
A0A673MXF5_MCL1-01      aagtgtgtgagtctggtgggggaagagatctcttcctatcttctcacaga
A0A673HSI2_MCL1-01      -ggtgcgtggagacggtggcccagcagatctcctcctatctgatctcaga
A0A673GSK0_MCL1-03      -ggtgcgtggagacggtgacccagcagatctcctcctatctgatctcaga
A0A673GSK0_MCL1-01      -ggtgcgtggagacggtgacccagcagatctcctcctatctgatctcaga
A0A673GSK0_MCL1-02      -ggtgcgtggagacggtgacccagcagatctcctcctatctgatctcaga
                          **            *         ***  *    ** **   *     

A0A673LV42_BCL2-01      gctgcacggctggatccaggagaacggcggatgggaggcgtttgtggagc
A0A673HVU7_BCL2-01      tctggaaaactggatcgaggaaaatggaggctgggatgccttcgtggag-
A0A673M4N6_BCL2L1-      aattcagccctggatccagagccaaggaggatggg---------------
A0A673IGS5_BCL2L1-      aattcagccctggatccagagccaaggaggatgggaacgcttcgcagaga
A0A673M4N6_BCL2L1-      aattcagccctggatccagagccaaggaggatgggaacgcttcgcagaga
A0A673IXK8_MCL1-01      ccagcgggactggctgctcaaaaacaatgcatgggatggctttgtggaat
A0A673MXF5_MCL1-01      ccaacgggactggctgctcaaaaacaaagcatgggatggctttgtggcat
A0A673HSI2_MCL1-01      acagcacgactggctgctcaacaacaagggctggcatgggttcgaggagt
A0A673GSK0_MCL1-03      acagcacgactggctgctcaacaacaa------gcatggattcgtggagt
A0A673GSK0_MCL1-01      acagcacgactggctgctcaacaacaa------gcatggattcgtggagt
A0A673GSK0_MCL1-02      acagcacgactggctgctcaacaacaa------gcatggattcgtggagt
                                 **** *        *         *                

A0A673LV42_BCL2-01      tctacggc-------------aggcagagggactctgtgtttcg------
A0A673HVU7_BCL2-01      ---t---tgtaca------gtcagcagagagactcagtgttccacccatt
A0A673M4N6_BCL2L1-      ---t---tggacg------agtggcaggtaa---tggag-----------
A0A673IGS5_BCL2L1-      tctt---tggaaaagatgcagcggcagagag---cagaaaatcaca----
A0A673M4N6_BCL2L1-      tctt---tggaaaagatgcagtggcagagag---cagaaaatcaca----
A0A673IXK8_MCL1-01      tttttcatgtcccaaatacagaagcggctgtgagaaacacattg------
A0A673MXF5_MCL1-01      tttttcatgtcccggatacagaggcagctatgagaaacacattg------
A0A673HSI2_MCL1-01      tcttccgcgtggaggacgtggagtctgtggtccgcagcgctctg------
A0A673GSK0_MCL1-03      ttttccacgtggaggatgtggagtctgtgattcgtaatgctttg------
A0A673GSK0_MCL1-01      ttttccacgtggaggatgtggagtctgtgattcgtaatgctttg------
A0A673GSK0_MCL1-02      ttttccacgtggaggatgtggagtctgtgattcgtaatgctttg------
                                                * *                       

A0A673LV42_BCL2-01      --------------cagctcgtggtcatcgatagtaacggtcttcggtct
A0A673HVU7_BCL2-01      ttcgtacctaactaaagtacttggat--tggcagtgctcggctt------
A0A673M4N6_BCL2L1-      ----------------------gggtcctggt-ccagtcagctt------
A0A673IGS5_BCL2L1-      -----agaaaacttcaagaagtggttgctggtgggaatgacctt------
A0A673M4N6_BCL2L1-      -----agaaaacttcaagaagtggttgctggcgggaatgacctt------
A0A673IXK8_MCL1-01      --------------------atggccattggtagtgt-------------
A0A673MXF5_MCL1-01      --------------------atggccattggtggtgt-------------
A0A673HSI2_MCL1-01      --------------------atggctg-ttgtgggat-------------
A0A673GSK0_MCL1-03      --------------------atggctg-tggtgggat-------------
A0A673GSK0_MCL1-01      --------------------atggctg-tggtgggat-------------
A0A673GSK0_MCL1-02      --------------------atggctg-tggtgggat-------------

A0A673LV42_BCL2-01      agcggctctcggggccgttggcttgaccataggagc-----ctaccttgc
A0A673HVU7_BCL2-01      ------------g---gcaggagtgaccatcggagc-----ctttttcgc
A0A673M4N6_BCL2L1-      ------------tttctct----ttgtgatcagggctgcgatctgattg-
A0A673IGS5_BCL2L1-      ------------gctcacgggtgtcgtggtcgggtc-----actcattgc
A0A673M4N6_BCL2L1-      ------------gctcactggtgtcgtggtcgggtc-----actcattgc
A0A673IXK8_MCL1-01      --------------------g-gctacattcggagc-----tgcacttgc
A0A673MXF5_MCL1-01      --------------------g-gcaacattcggagc-----tgctcttgc
A0A673HSI2_MCL1-01      --------------------gtgctgggatcggcgc-----cggtctcgc
A0A673GSK0_MCL1-03      --------------------gcgctgggatcggcgc-----cggtctcgc
A0A673GSK0_MCL1-01      --------------------gcgctgggatcggcgc-----cggtctcgc
A0A673GSK0_MCL1-02      --------------------gcgctgggatcggcgc-----cggtctcgc
                                                     *  *  *          * * 

A0A673LV42_BCL2-01      tcagaa------atga
A0A673HVU7_BCL2-01      tcagaa------gtga
A0A673M4N6_BCL2L1-      -----------ggtga
A0A673IGS5_BCL2L1-      acaaaaacgcctgtga
A0A673M4N6_BCL2L1-      acagaaacgcctgtga
A0A673IXK8_MCL1-01      ttatttgatacggtga
A0A673MXF5_MCL1-01      ttatttgatacggtga
A0A673HSI2_MCL1-01      tctcctgatccgatga
A0A673GSK0_MCL1-03      tttcctgatccggtga
A0A673GSK0_MCL1-01      tttcctgatccggtga
A0A673GSK0_MCL1-02      tttcctgatccggtga

© 1998-2021Legal notice