Dataset for CDS BCL-2-like of organism Sinocyclocheilus rhinocerous

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A673GSK0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=837 residues).
atgctgaaaatacagctgcgcatcacagaaataaattacagtttaacagatattcacatagaaaacagttattttaaata
tttagtcagaagaacggctgcggtcagtctgctcggcgcgcacacggcgctcgtgcccgcgcccgcactcaaaccgcgga
gcgaggacgagctcgacgggtgcgcggatgaaccggacgccgcggtgaagccggtaagaccgggaaccaacggcctgaag
ggactgcaactggacggacgcttcgtttgcgcggcggacggatctctaccgaacacaccggacccgcaggagttcggttc
cgccgaactggatcgcgacacgagacagctcttgttggatttctaccgcacgcacaccggaatgtgtccgcaggaccgga
agcagcatcacgcgctaccgacaatgactcgcgttgtcgcggacgttctcttaaagcacgagactacattcaaaggaatg
ttgcagcgtctacagctggaatctcaagcagacgacatgagcttcatcagctttatagcagagacgatgttcagagacga
caccaccaactggggccggatcgtgagtctggtggccttcggggctgtggtgtgctcgcgtctgaaagagctgcagaggg
agcggtgcgtggagacggtgacccagcagatctcctcctatctgatctcagaacagcacgactggctgctcaacaacaag
catggattcgtggagtttttccacgtggaggatgtggagtctgtgattcgtaatgctttgatggctgtggtgggatgcgc
tgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A673GSK0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=621 residues).
ataccgggaaccaacggcctgaagggactgcaactggacggacgcttcgtttgcgcggcggacggatctctaccgaacac
accggacccgcaggagttcggttccgccgaactggatcgcgacacgagacagctcttgttggatttctaccgcacgcaca
ccggaatgtgtccgcaggaccggaagcagcatcacgcgctaccgacaatgactcgcgttgtcgcggacgttctcttaaag
cacgagactacattcaaaggaatgttgcagcgtctacagctggaatctcaagcagacgacatgagcttcatcagctttat
agcagagacgatgttcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggggctgtggtgtgct
cgcgtctgaaagagctgcagagggagcggtgcgtggagacggtgacccagcagatctcctcctatctgatctcagaacag
cacgactggctgctcaacaacaagcatggattcgtggagtttttccacgtggaggatgtggagtctgtgattcgtaatgc
tttgatggctgtggtgggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A673GSK0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=708 residues).
ctaagctttaaccttcgacgttcagaccgactcgaagacgagctcgacgggtgcgcggatgaaccggacgccgcggtgaa
gccggtaagaccgggaaccaacggcctgaagggactgcaactggacggacgcttcgtttgcgcggcggacggatctctac
cgaacacaccggacccgcaggagttcggttccgccgaactggatcgcgacacgagacagctcttgttggatttctaccgc
acgcacaccggaatgtgtccgcaggaccggaagcagcatcacgcgctaccgacaatgactcgcgttgtcgcggacgttct
cttaaagcacgagactacattcaaaggaatgttgcagcgtctacagctggaatctcaagcagacgacatgagcttcatca
gctttatagcagagacgatgttcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggggctgtg
gtgtgctcgcgtctgaaagagctgcagagggagcggtgcgtggagacggtgacccagcagatctcctcctatctgatctc
agaacagcacgactggctgctcaacaacaagcatggattcgtggagtttttccacgtggaggatgtggagtctgtgattc
gtaatgctttgatggctgtggtgggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A673HSI2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=693 residues).
atgactctgagtttggggaatagaccgatggctgcgttgggtgtcctcgcggatgagacggacgccgcgctgaagccgct
gaggcccgggacgaacggcctgaaaggactgcagctggacggacggttcgtgtccgcgggagacggctctctaccggcca
ccccggacccgcaggagctcggttccgacacgcagcagcttctgttggacttctatcgcacgcacaccggaatgagtctc
ccggatcggaagcgtcatcacgcgttaccgacaatgaagcgcgtcgtcgcggacgtcctcataaagcaccagatcactta
cacagggatgctgcagcgtctgcagctggactctcagccggacgacttgagcgtcatcgactgtatagcaaagacgatgt
tcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcagctgaaggag
ctgcagagggagcggtgcgtggagacggtggcccagcagatctcctcctatctgatctcagaacagcacgactggctgct
caacaacaagggctggcatgggttcgaggagttcttccgcgtggaggacgtggagtctgtggtccgcagcgctctgatgg
ctgttgtgggatgtgctgggatcggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A673HVU7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL-2 (length=690 residues).
atggccaccgaaattcgctttgacaatcggaatattgtggagaaatacatcaatcacaaactttcaaagaagggatatgt
gtggaaatctcaatcttctggggaggatgatgacaccgccaataaaggaatcgagggttcctctctaaactctggcagga
ggcttcaggctccctcagccggaggggggaacaactctgaatgcctgatagctcaccgggtcactcgttcagacccttat
tcaaggatctaccgggcgctacgcgaggctggagacgagatagaaaggctataccagcgtgaatttgaggagatgtccca
ccgcatgatattcagtcccaatacaacgcaacgcagcttcttagccgtggcagaagagctctttaaagacggagtgaact
gggggcggatcatcgctttctttgagtttggtgggaccatgtgtgtggagagcgtcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggcctctggaaaactggatcgaggaaaatggaggctgggatgc
cttcgtggagttgtacagtcagcagagagactcagtgttccacccattttcgtacctaactaaagtacttggattggcag
tgctcggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
>gnl|bcl2dbcds|A0A673IGS5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL2L1 (length=720 residues).
atgtcttactatcaccaagaactggtggtattttttattaaatataaactctcgcagaggaactacccctacaaccacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacaacgaccctcg
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acgaacgggactgggggtctggacgctgtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacggcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgcctttggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccactagtgggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagcggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggtgggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacaaaaacgcctgtga
>gnl|bcl2dbcds|A0A673IXK8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=747 residues).
atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcattggaataacagctcttaacgtcaacagcag
ctcgggcgggcttggtcgcaagccactggtaatgccagaactgaaaccccagaaccagtttacagggaacggactccagg
gctcggtaccatcctcgcctgagccggattgcgaggaagtacaagatgaatacacgtccatctatgacgctctggaaatg
gacacacgagagattattgacattttcttaaaaaactttactggattccctcattctaaaagtgggaataaacaggttct
ggcaacgatgaatcgggttgtggaaagtcttgtggtgaagcacgaactggcttacaaaggtatgattgcacgtctgaatc
tggagcagaaaggagaagatgtgagtttcgtcaagactgttgcaacagaactcttcagcgatggcatcacaaactggggt
cgcattgccagcctgcttactcttggggcaatggtatgcaagcatcagaatgataaaggacttagcaagtgtgcgagtct
ggtggggaaagagatctcttcctatcttctcataacccagcgggactggctgctcaaaaacaatgcatgggatggctttg
tggaattttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggccattggtagtgtggctacattcgga
gctgcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A673LV42_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL-2 (length=672 residues).
atggcacaggagaatgtgtatgataaccggagcatagtggtgaagtacatccaccataagctctggaagaagggatacgt
gtgggaagtgaacggacacgatgacagcgtctcgaatggactgatgatggagaggcgggaggacggcggcatctctccca
gctcccgtcacgacccgtgcagggctcttcataaggtgctctcccgtcacgacccgtgcagggctcttcataaggtgctg
cgggaggccggggatgaactggagcggctttatcagtcggactttgcggagatgtccaaacggctgcacctcacgtccat
cacggcgcatcagcgcttcaccgcggtcatagacgagctgttcggggacggcgtgaactggggcagaatcatcgcttttt
tcgagtttggagggactgtttgtgtcgaatgcgtgaataaggagatgatggcgcatgtggataacattgcgggctggatg
accgagtatctgaacgggccgctgcacggctggatccaggagaacggcggatgggaggcgtttgtggagctctacggcag
gcagagggactctgtgtttcgcagctcgtggtcatcgatagtaacggtcttcggtctagcggctctcggggccgttggct
tgaccataggagcctaccttgctcagaaatga
>gnl|bcl2dbcds|A0A673M4N6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL2L1 (length=720 residues).
atgtcttactatcaccaagaactggtggtattttttattaaatataaactctcacagaggaactacccctacaatcacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacaacgaccctcg
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acgaacgggactgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcgtcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcggattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagtggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggcgggaatgaccttgctcactggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A673M4N6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL2L1 (length=660 residues).
atgtcttactatcaccaagaactggtggtattttttattaaatataaactctcacagaggaactacccctacaatcacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacaacgaccctcg
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acgaacgggactgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcgtcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcggattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggttggacgagtggcaggtaatggaggggtcctggtccagtcagctttttctctttgtgatcagg
gctgcgatctgattgggtga
>gnl|bcl2dbcds|A0A673MXF5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=744 residues).
atgttccctgggagtaaagtttcaaacgacagcggcttttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccacttgtaatgccagaactgaaagcccagaaccagttcacagggaacggtctccagg
gctcggtaccatcctcgcctgagacggactgcgaggaaatagatgattacacctccatctacgccgccctggaaatggac
acgcgagagattattgacgctttcttaaaaagctttacaggactccctcattctaaaagtggaaaaaaccaggttctgtc
tacgatgaagcgggttgtggacagtctcgcggtgaagcacgaactggcttacaaaggtatgattgcacggctgaatctgg
agcagaaaggagaagatgtgagttttgtcaagactgtggcaacagaactcttcagcgatggcatcacaaactgggggcgc
atttgcagcctgctgacttttggggcactggtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacgggactggctgctcaaaaacaaagcatgggatggctttgtgg
cattttttcatgtcccggatacagaggcagctatgagaaacacattgatggccattggtggtgtggcaacattcggagct
gctcttgcttatttgatacggtga
© 1998-2020Legal notice