Dataset for CDS MCL-1 of organism Microcebus murinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5VC33_MCL1-01      ---------------------------------------ctct-------
A0A8B7GKA0_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A8B7GKA0_MCL1-02      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A8B7GKA0_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
                                                               ****       

A0A8C5VC33_MCL1-01      ------------------------------------------------gt
A0A8B7GKA0_MCL1-01      aggggccggattgggggccggcagcagcggcgccacccccccgggagggc
A0A8B7GKA0_MCL1-02      aggggccggattgggggccggcagcagcggcgccacccccccgggagggc
A0A8B7GKA0_MCL1-03      aggggccggattgggggccggcagcagcggcgccacccccccgggagggc
                                                                        * 

A0A8C5VC33_MCL1-01      gtcttatatct---------------------------------------
A0A8B7GKA0_MCL1-01      ggcttttggctgccgagaaggaggccactgcccggcgagaggtaggggga
A0A8B7GKA0_MCL1-02      ggcttttggctgccgagaaggaggccactgcccggcgagaggtaggggga
A0A8B7GKA0_MCL1-03      ggctttt-------------------------------------------
                        * *** *                                           

A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      ggggaagccggcacggtgattggcggaagccccggcgcaagccccccggc
A0A8B7GKA0_MCL1-02      ggggaagccggcacggtgattggcggaagccccggcgcaagccccccggc
A0A8B7GKA0_MCL1-03      --------------------------------------------------
                                                                          

A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      ctccctcacgccagacgcccggagggtcgcgcggccggcgcccattggtg
A0A8B7GKA0_MCL1-02      ctccctcacgccagacgcccggagggtcgcgcggccggcgcccattggtg
A0A8B7GKA0_MCL1-03      --------------------------------------------------
                                                                          

A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      ccgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcg
A0A8B7GKA0_MCL1-02      ccgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcg
A0A8B7GKA0_MCL1-03      --------------------------------------------------
                                                                          

A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      cccacccgccgcgcggtgccgcctgaggagatggaagcccctgccgccga
A0A8B7GKA0_MCL1-02      cccacccgccgcgcggtgccgcctgaggagatggaagcccctgccgccga
A0A8B7GKA0_MCL1-03      --------------------------------------------------
                                                                          

A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      cgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
A0A8B7GKA0_MCL1-02      cgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
A0A8B7GKA0_MCL1-03      --------------------------------------------------
                                                                          

A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
A0A8B7GKA0_MCL1-02      tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
A0A8B7GKA0_MCL1-03      --------------------------------------------------
                                                                          

A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      agtaatggctccggcacggaagggtcactaccctcgacgccgcccccagc
A0A8B7GKA0_MCL1-02      agtaatggctccggcacggaagggtcactaccctcgacgccgcccccagc
A0A8B7GKA0_MCL1-03      --------------------------------------------------
                                                                          

A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A8B7GKA0_MCL1-02      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A8B7GKA0_MCL1-03      --------------------------------------------------
                                                                          

A0A8C5VC33_MCL1-01      -------------------------------------------------c
A0A8B7GKA0_MCL1-01      ggtaccttcgggagcaggcaaccggcgccaaggacgcaaagccaatgggc
A0A8B7GKA0_MCL1-02      ggtaccttcgggagcaggcaaccggcgccaaggacgcaaagccaatgggc
A0A8B7GKA0_MCL1-03      ----------------ggcaaccggcgccaaggacgcaaagccaatgggc
                                                                         *

A0A8C5VC33_MCL1-01      agttgtggg---------aaaaaggatc-----------ccatgtgtt--
A0A8B7GKA0_MCL1-01      aggtctggggccgccagcaggaaggcgctagagaccttacgacgtgtcgg
A0A8B7GKA0_MCL1-02      aggtctggggccgccagcaggaaggcgctagagaccttacgacgtgtcgg
A0A8B7GKA0_MCL1-03      aggtctggggccgccagcaggaaggcgctagagaccttacgacgtgtcgg
                        ** * ****         *  ****  *           * * ****   

A0A8C5VC33_MCL1-01      -----------------------------tcttcctatgtctggttag--
A0A8B7GKA0_MCL1-01      ggacggtgtgcagcgcaaccatcagacggccttccaa-------------
A0A8B7GKA0_MCL1-02      ggacggtgtgcagcgcaaccatcagacggccttccaaggcatgcttcgga
A0A8B7GKA0_MCL1-03      ggacggtgtgcagcgcaaccatcagacggccttccaaggcatgcttcgga
                                                      ***** *             

A0A8C5VC33_MCL1-01      -------------------aaacgatgtcaaatctttgtctcgagtgatg
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A8B7GKA0_MCL1-03      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
                                                                          

A0A8C5VC33_MCL1-01      gtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      gtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
A0A8B7GKA0_MCL1-03      gtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
                                                                          

A0A8C5VC33_MCL1-01      aatttcttttggtgcctttgtggccaaacacctgaagagcataaaccaag
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      aatttcttttggtgcctttgtggccaaacacttgaagagcataaatcaag
A0A8B7GKA0_MCL1-03      aatttcttttggtgcctttgtggccaaacacttgaagagcataaatcaag
                                                                          

A0A8C5VC33_MCL1-01      aaagctgcatcgaaccattagcagaaagtatcacagacgttcttgtaagg
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      aaagctgcatcgaaccattagcagaaagtatcacagacgttcttgtaagg
A0A8B7GKA0_MCL1-03      aaagctgcatcgaaccattagcagaaagtatcacagacgttcttgtaagg
                                                                          

A0A8C5VC33_MCL1-01      acaaaacgagattggctagtcaaacaaagaggctgggatgggtttgtgga
A0A8B7GKA0_MCL1-01      -----------------------------------ggatgggtttgtgga
A0A8B7GKA0_MCL1-02      acaaaacgagattggctagtcaaacaaagaggctgggatgggtttgtgga
A0A8B7GKA0_MCL1-03      acaaaacgagattggctagtcaaacaaagaggctgggatgggtttgtgga
                                                           ***************

A0A8C5VC33_MCL1-01      gttcttccatgtagaggacctcgaaggcggcatcagaaatgtgctgctgg
A0A8B7GKA0_MCL1-01      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A8B7GKA0_MCL1-02      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A8B7GKA0_MCL1-03      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
                        ********************* ***** **********************

A0A8C5VC33_MCL1-01      cttttgcaggtgttgctggagtagcagctggtttggcatatctaat-aga
A0A8B7GKA0_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A8B7GKA0_MCL1-02      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A8B7GKA0_MCL1-03      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
                        ************************ ********************* ***

A0A8C5VC33_MCL1-01      tagccttgtatgtgcagtaatgggcttctaa
A0A8B7GKA0_MCL1-01      tagccttgtaa--------------------
A0A8B7GKA0_MCL1-02      tag----------------------------
A0A8B7GKA0_MCL1-03      tag----------------------------
                        ***                            

© 1998-2022Legal notice