Dataset for CDS MCL-1 of organism Microcebus murinus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccactgcccggcgagaggtagggggaggggaagccg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagacgcccggagggtcgcgcggccggcg
cccattggtgccgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgcccacccgccgcgcggtgcc
gcctgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccggcacggaagggtcacta
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccactgcccggcgagaggtagggggaggggaagccg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagacgcccggagggtcgcgcggccggcg
cccattggtgccgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgcccacccgccgcgcggtgcc
gcctgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccggcacggaagggtcacta
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaatcaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgagattggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagca
ggaaggcgctagagaccttacgacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaa
ctggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaatcaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagattggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C5VC33_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=426 residues).
ctctgtgtcttatatctcagttgtgggaaaaaggatcccatgtgtttcttcctatgtctggttagaaacgatgtcaaatc
tttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactctaatttcttttggtg
cctttgtggccaaacacctgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctt
gtaaggacaaaacgagattggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctcga
aggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtagcagctggtttggcatatctaatagatagcc
ttgtatgtgcagtaatgggcttctaa
© 1998-2022Legal notice