Dataset for CDS BAX of Organism Lynx canadensis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A667HTQ5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Lynx canadensis GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacgcccgagctggccttggagcaggtgccccaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggagatgaactggacagtaacatggaattgcagaggatgatt
gcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttttccgatggcaacttcaactg
gggccgggtcgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatcc
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtgctgactgcgtcactcaccat
ctggaaaaagatgggctga
>gnl|bcl2dbcds|A0A667HTQ5_BAX-02 BCL2-associated X gene OS=[Eukaryota] Lynx canadensis GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttttccgatg
gcaacttcaactggggccgggtcgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtg
cccgagctgatccggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccaggg
tggttgggacggcctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtgctgactg
cgtcactcaccatctggaaaaagatgggctga
© 1998-2023Legal notice