Dataset for CDS BCL2L1 of organism Ovis aries

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q9MZS7_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcttacaagct
W5PSA5_BCL2L1-01      atgtctcagagcaaccgggaactagtggttgactttctctcttacaagtt
                      ******************** ** ************************ *

Q9MZS7_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
W5PSA5_BCL2L1-01      ttttcagaaaggatacagctggagtcagtttagtgacatggaagagaaca
                      **  ********************************  ************

Q9MZS7_BCL2L1-01      gaactgaggccccagaagggacagaatcagatatggaaacccccagtgcc
W5PSA5_BCL2L1-01      gaactgagaccctagaagggacagaatcagatatggaaacccccagtgcc
                      ******** *** *************************************

Q9MZS7_BCL2L1-01      atcaatggcaacccatcttggcacctggcggatagccctgcggtgaatgg
W5PSA5_BCL2L1-01      atcagtggcaacccatcctggcacctggcagatagccctgtggtgaatgg
                      **** ************ *********** ********** *********

Q9MZS7_BCL2L1-01      agccaccggccacagcagaagcttggatgcccgggaagtgatccccatgg
W5PSA5_BCL2L1-01      agccactggtcacagcagaagcttggacaccgggaaaatgatccccatgg
                      ****** ** *****************  ** ** ** ************

Q9MZS7_BCL2L1-01      cagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgagg
W5PSA5_BCL2L1-01      cagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgagg
                      *** ************************* ** ****** **** *****

Q9MZS7_BCL2L1-01      taccgacgggcattcagcgacctgacgtcccagctccacatcaccccagg
W5PSA5_BCL2L1-01      taccaacagacattcagcgacctgacgtcccagctccacatcaccccagg
                      **** ** * ****************************************

Q9MZS7_BCL2L1-01      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
W5PSA5_BCL2L1-01      gaaagcatatcagagctttgaacaggtaataaatgaactcttccaggatg
                      ** ************************* * ************* *** *

Q9MZS7_BCL2L1-01      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
W5PSA5_BCL2L1-01      gggtgaactggggtcgcaatgtggcctttttctccttcggtggggcacta
                      ****************** ****************************** 

Q9MZS7_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
W5PSA5_BCL2L1-01      tgcatgaaaagcatagtcaaggagatgcaggtattggtaagtcaggtcac
                      *** ** ***** *** ********************* **** * ** *

Q9MZS7_BCL2L1-01      aacttggatggctacttacctgaatgaccacctagagccttggatccagg
W5PSA5_BCL2L1-01      gacttggatggccacttacctaaatgaccacctagagccttggatccagg
                       *********** ******** ****************************

Q9MZS7_BCL2L1-01      agaacggcggctgggacacgtttgtggaactctacgggaacaacgcagca
W5PSA5_BCL2L1-01      agaatggcgactgggacatttttgtggaactctacgaaaacaatacagca
                      **** **** ********  ****************  *****  *****

Q9MZS7_BCL2L1-01      gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacggg
W5PSA5_BCL2L1-01      accgagagccaaaagggccaagagcacctcaaccgctggtccctgacgga
                       *********  ******** **** * ************ ******** 

Q9MZS7_BCL2L1-01      catgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaat
W5PSA5_BCL2L1-01      catgactgtggccggtatggctctgctgggcttgctcttcaactgtaag-
                      ************ *** *** *********** ********   * **  

Q9MZS7_BCL2L1-01      ga
W5PSA5_BCL2L1-01      --

© 1998-2020Legal notice