Dataset for CDS BAX of Organism Erpetoichthys calabaricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4T7F8_BAX-01      -atggcatattcagccccggaagatgagtatggatgttcttgtgctgaag
A0A8C4T7F8_BAX-02      -atggcatattcagccccggaagatgagtatggatgttcttgtgctgaag
A0A8C4SXA2_BAX-01      acttctacaattag--cggaaagacagatactggtgtt--tttcatttat
A0A8C4XH90_BAX-01      ----------------------------tactgttttttctctcgtttct
                                                   **  * * **  * *  *    

A0A8C4T7F8_BAX-01      gtggtgatcaagtcagtgaacaagctgaagttgtcttgcgtggatatatt
A0A8C4T7F8_BAX-02      gtggtgatcaagtcagtgaacaagctgaagttgtcttgcgtggatatatt
A0A8C4SXA2_BAX-01      gtt---attttattcatgattacg-------tgtctcacgaaagtgagtt
A0A8C4XH90_BAX-01      attgcagttttatccacgatcgtg-------tgtctcgtga-----agca
                        *     *    *    **    *       *****   *          

A0A8C4T7F8_BAX-01      ttacagtcgatgaggcatgacaattgtccaggtgtgaacatcagtgcaga
A0A8C4T7F8_BAX-02      ttacagtcgatgaggcatgacaattgtccaggtgtgaacatcagtgcaga
A0A8C4SXA2_BAX-01      aaactctgaatttgatccgatttcggtacagcttcg--------------
A0A8C4XH90_BAX-01      gcactcacaggatcatatggt-----------------------------
                         **              *                               

A0A8C4T7F8_BAX-01      agatttgggtggatctcaaagtgaaagtacaaatcccgaagtaaaggaca
A0A8C4T7F8_BAX-02      agatttgggtggatctcaaagtgaaagtacaaatcccgaagtaaaggaca
A0A8C4SXA2_BAX-01      ----------ggaccccaggcatgaaaaac--------------------
A0A8C4XH90_BAX-01      -----------gatct----------gaac--------------------
                                  ** *             **                    

A0A8C4T7F8_BAX-01      tagtacgaagtttgatacaaattggagat---------gaactaagcagg
A0A8C4T7F8_BAX-02      tagtacgaagtttgatacaaattggagat---------gaactaagcagg
A0A8C4SXA2_BAX-01      --------tct-taaacaaacttgttgacatttcaaagaggttagatggt
A0A8C4XH90_BAX-01      --------tgtctaagaaaaattggtgac---------gagttggatggc
                                 * * *   ** ***  **              *     * 

A0A8C4T7F8_BAX-01      aacactgaacttgagtaccttattgatcacattgaa-tttagctcagcac
A0A8C4T7F8_BAX-02      aacactgaacttgagtaccttattgatcacattgaa-tttagctcagcac
A0A8C4SXA2_BAX-01      gatgaagaacttcagcaattaattaacgacg------tccaaccaagcag
A0A8C4XH90_BAX-01      aacatggagcttcagcaaatgattaacagctcagctcttcaaccaaacaa
                        *    ** *** ** *  * *** *   *       *  * *  * ** 

A0A8C4T7F8_BAX-01      ag-gaagttttta-atattgtggccaagagaatttttgaagatggaatta
A0A8C4T7F8_BAX-02      ag-gaagttttta-atattgtggccaagagaatttttgaagatggaatta
A0A8C4SXA2_BAX-01      ggagacattcctacaggttgcacatcagttattttgtaatggaaatttga
A0A8C4XH90_BAX-01      agaggtgttcttccaggttgcagctcagatgttcagtgatggtaaattaa
                        * *   **  *  *  ***      **    *   * * *      * *

A0A8C4T7F8_BAX-01      actggggcagagtggtcgccctttttcattttgcttacaaactaatatgc
A0A8C4T7F8_BAX-02      actggggcagagtggtcgccctttttcattttgcttacaaactaatatgc
A0A8C4SXA2_BAX-01      actggggccgcctgatagctttattttactttgcctgtaaattggcaatg
A0A8C4XH90_BAX-01      actggggacgcatagttgcattattctattttgcctgcaagttggtgatg
                       *******  *  *  * **  * **  * ***** *  **  *       

A0A8C4T7F8_BAX-01      aaggccataacttcaaattgcaaagagatggttagaagagtaatgtactg
A0A8C4T7F8_BAX-02      aaggccataacttcaaattgcaaagagatggttagaagagtaatgtactg
A0A8C4SXA2_BAX-01      aaggctttaaggcagaaagccgaagaaattgtgacatgtataatatcatg
A0A8C4XH90_BAX-01      aaggctttagtgacaaaatttccagaaatggtgaggacaatcatcacctg
                       *****  **      **      *** ** ** *      * **    **

A0A8C4T7F8_BAX-01      ggc-attaggattttttaggacccgcatttcctgg--tgggttagagaac
A0A8C4T7F8_BAX-02      ggc-attaggattttttaggacccgcatttcctgg--tgggttagagaac
A0A8C4SXA2_BAX-01      gacaattaattatatcaggga---gcatctgcttatttggatcatggatc
A0A8C4XH90_BAX-01      gaccattgactacctccatga---gcatttgctgaattggatcagggatc
                       * * ***       *    **   **** * **    *** * *  ** *

A0A8C4T7F8_BAX-01      aaggaggatggatgttgacgagcaataagcaaaaggtatcgctgaaaacc
A0A8C4T7F8_BAX-02      aaggaggatggg-------gagcagt---tcaaagctattt---------
A0A8C4SXA2_BAX-01      agggtggttggg-------agggaatcctctca---ta---taatcaatc
A0A8C4XH90_BAX-01      agggtggttggg-------agggaatacggtca---tattttggtacacc
                       * ** ** ***          * * *      *   **            

A0A8C4T7F8_BAX-01      accgaaaacaaaaacagcaaaaaaaaaaaaaagtacaaggaaagttcgaa
A0A8C4T7F8_BAX-02      -tcaaagtctgaactggccaaacg--------------------------
A0A8C4SXA2_BAX-01      tttgtggcctacagtag---------------------------------
A0A8C4XH90_BAX-01      tacctggcagacagtag---------------------------------
                                   *   *                                 

A0A8C4T7F8_BAX-01      gaaagaaaaaaaaatgtacaatgtttctgtttggggatcgttgtgcacaa
A0A8C4T7F8_BAX-02      ---------------ttgcactgtttgtagctgga-------gtcctcac
A0A8C4SXA2_BAX-01      ---------------gtg---tgttcatagcggga-------gtcataac
A0A8C4XH90_BAX-01      ---------------gtg---ttttcttagctgga-------gtacttac
                                       *    * **  *    **        **    * 

A0A8C4T7F8_BAX-01      ctgagct---gcat-----------ccatag
A0A8C4T7F8_BAX-02      tggagctatggcatattggaaaatgtcttaa
A0A8C4SXA2_BAX-01      ggcagtggtggccatgcggcgactgtcatga
A0A8C4XH90_BAX-01      cacagtacttgtcattcataaaatgtcatga
                          **     *               * *  

© 1998-2023Legal notice