Dataset for CDS BCL2L10 of organism Equus caballus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F6ZPD4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Equus caballus GN=BCL2L10 (length=561 residues).
gccgtggcggaggcgctgagggagcgcacggcgctactgctgatcgactacctgcagcgccgcgcccgggagccggccac
gcccgaggtggccgtgctgcgctgcgtggccgcccagatacagccccgcaaccagcgtgttctttcccgctaccgcggct
tccgcggggaccacgtcgggctggcggcacggatggcgcaggcgatcttcggagaccgccacgtccccagctggggccgc
gtggcggcgctcgtgaccctggcggggacgctgctggagagagccccgcggggaacctaccgaaagccgaagcggggcta
caagctggagctgagggagtggaaggccggcgtggaccgggactggccgcgcctggtggacttcctgtgcgcatggctca
aggggcggcaccgcgcctggctggaggctcactatggctgggatggcttttgtgacttctcactcacactgccagcttct
cagaggatactgctggtccggtttcttctgtcatgcttttcagcatcagtcttaatctacctctggacaaaattatcatg
a
© 1998-2020Legal notice