Dataset for CDS MCL-1 of organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H9GEA6_MCL1-01      atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaac
H9GEA6_MCL1-02      atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaac
H9GEA6_MCL1-03      atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaac
                    ************************************************************

H9GEA6_MCL1-01      acgccggcctcacctggagccggcggaggcgtcggagaaagtagcggcgggaataataac
H9GEA6_MCL1-02      acgccggcctcacctggagccggcggaggcgtcggagaaagtagcggcgggaataataac
H9GEA6_MCL1-03      acgccggcctcacctggagccggcggaggcgtcggagaaagtagcggcgggaataataac
                    ************************************************************

H9GEA6_MCL1-01      gacggcggcggcgtctcggttccgaaggcctcaggtcttttctcagagaggccgcgccct
H9GEA6_MCL1-02      gacggcggcggcgtctcggttccgaaggcctcaggtcttttctcagagaggccgcgccct
H9GEA6_MCL1-03      gacggcggcggcgtctcggttccgaaggcctcaggtcttttctcagagaggccgcgccct
                    ************************************************************

H9GEA6_MCL1-01      ctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
H9GEA6_MCL1-02      ctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
H9GEA6_MCL1-03      ctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
                    ************************************************************

H9GEA6_MCL1-01      tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
H9GEA6_MCL1-02      tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
H9GEA6_MCL1-03      tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
                    ************************************************************

H9GEA6_MCL1-01      ccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagccgaggaggag
H9GEA6_MCL1-02      ccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagccgaggaggag
H9GEA6_MCL1-03      ccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagccgaggaggag
                    ************************************************************

H9GEA6_MCL1-01      gaggccgcgacggtgccgtcttccaccccctcgccggacaaagagatggcggaggaggaa
H9GEA6_MCL1-02      gaggccgcgacggtgccgtcttccaccccctcgccggacaaagagatggcggaggaggaa
H9GEA6_MCL1-03      gaggccgcgacggtgccgtcttccaccccctcgccggacaaagagatggcggaggaggaa
                    ************************************************************

H9GEA6_MCL1-01      ggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
H9GEA6_MCL1-02      ggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
H9GEA6_MCL1-03      ggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
                    ************************************************************

H9GEA6_MCL1-01      gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccggg
H9GEA6_MCL1-02      gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccggg
H9GEA6_MCL1-03      gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccggg
                    ************************************************************

H9GEA6_MCL1-01      cccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggag
H9GEA6_MCL1-02      cccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggag
H9GEA6_MCL1-03      cccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggag
                    ************************************************************

H9GEA6_MCL1-01      gtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctccgggagaagcacctg
H9GEA6_MCL1-02      gtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctccgggagaagcacctg
H9GEA6_MCL1-03      gtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctccgggagaagcacctg
                    ************************************************************

H9GEA6_MCL1-01      ctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
H9GEA6_MCL1-02      ctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
H9GEA6_MCL1-03      ctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
                    ************************************************************

H9GEA6_MCL1-01      gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtg
H9GEA6_MCL1-02      gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtg
H9GEA6_MCL1-03      gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtg
                    ************************************************************

H9GEA6_MCL1-01      actctcatctcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaat
H9GEA6_MCL1-02      actctcatctcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaat
H9GEA6_MCL1-03      actctcatctcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaat
                    ************************************************************

H9GEA6_MCL1-01      gctatcaacactttaatagaaattatcactgatgtgctggtgacggacaagagagaatgg
H9GEA6_MCL1-02      gctatcaacactttaatagaaattatcactgatgtgctggtgacggacaagagagaatgg
H9GEA6_MCL1-03      gctatcaacactttaatagaaattatcactgatgtgctggtgacggacaagagagaatgg
                    ************************************************************

H9GEA6_MCL1-01      ctattgaaacataatgcctggcaacgtgctcggctcggcagcgccactctgcggatccac
H9GEA6_MCL1-02      ctattgaaacataatgcctggcaacgtgctcggctcggcagcgccactctgcggatccac
H9GEA6_MCL1-03      ctattgaaacataatgcctggga--gggatttgttcagttcttccatgtagagg----ac
                    ********************* *  * * *  * ** *     ***    * **    **

H9GEA6_MCL1-01      ctcgaagcagtcactctcgttttcctcaattttcaagtccaggctgttttcgtccgccat
H9GEA6_MCL1-02      ctcgaagcagtcactctcgttttcctcaattttcaagtccaggctgttttcgtccgccat
H9GEA6_MCL1-03      atagaaggtggca---------tcaggaat------gttctggtggcttttgccag-tgt
                     * ****  * **         **   ***      ** * **  * *** * * *   *

H9GEA6_MCL1-01      ggcttccttggatctgagagaggaaagcagcagcacaactgtgt--ctga
H9GEA6_MCL1-02      ggcttccttggatctgagagaggaaagcagcagcacacctgtcc--gtga
H9GEA6_MCL1-03      ggc-----tgga----ataggggcaggc-ttggcctacatgatccggtga
                    ***     ****    * ** ** * **    **  *  **      ***

© 1998-2022Legal notice