Dataset for CDS MCL-1 of organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A803T0A4_MCL1-01      atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcat
A0A803T0A4_MCL1-02      atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcat
A0A803T0A4_MCL1-03      atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcat
                        **************************************************

A0A803T0A4_MCL1-01      ggccccgaacacgccggcctcacctggagccggcggaggcgtcggagaaa
A0A803T0A4_MCL1-02      ggccccgaacacgccggcctcacctggagccggcggaggcgtcggagaaa
A0A803T0A4_MCL1-03      ggccccgaacacgccggcctcacctggagccggcggaggcgtcggagaaa
                        **************************************************

A0A803T0A4_MCL1-01      gtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcc
A0A803T0A4_MCL1-02      gtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcc
A0A803T0A4_MCL1-03      gtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcc
                        **************************************************

A0A803T0A4_MCL1-01      tcaggtcttttctcagagaggccgcgccctctgattggcggggggcctcg
A0A803T0A4_MCL1-02      tcaggtcttttctcagagaggccgcgccctctgattggcggggggcctcg
A0A803T0A4_MCL1-03      tcaggtcttttctcagagaggccgcgccctctgattggcggggggcctcg
                        **************************************************

A0A803T0A4_MCL1-01      cgccggacccctgagggcgctgattggcccctgggaggggtctcagcggg
A0A803T0A4_MCL1-02      cgccggacccctgagggcgctgattggcccctgggaggggtctcagcggg
A0A803T0A4_MCL1-03      cgccggacccctgagggcgctgattggcccctgggaggggtctcagcggg
                        **************************************************

A0A803T0A4_MCL1-01      cgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
A0A803T0A4_MCL1-02      cgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
A0A803T0A4_MCL1-03      cgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
                        **************************************************

A0A803T0A4_MCL1-01      ccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagc
A0A803T0A4_MCL1-02      ccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagc
A0A803T0A4_MCL1-03      ccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagc
                        **************************************************

A0A803T0A4_MCL1-01      cgaggaggaggaggccgcgacggtgccgtcttccaccccctcgccggaca
A0A803T0A4_MCL1-02      cgaggaggaggaggccgcgacggtgccgtcttccaccccctcgccggaca
A0A803T0A4_MCL1-03      cgaggaggaggaggccgcgacggtgccgtcttccaccccctcgccggaca
                        **************************************************

A0A803T0A4_MCL1-01      aagagatggcggaggaggaaggagagaaagggaaaggagggccccctctc
A0A803T0A4_MCL1-02      aagagatggcggaggaggaaggagagaaagggaaaggagggccccctctc
A0A803T0A4_MCL1-03      aagagatggcggaggaggaaggagagaaagggaaaggagggccccctctc
                        **************************************************

A0A803T0A4_MCL1-01      ttcccggaccacctgcggaagacgacgctggaagtggtaggccgctacct
A0A803T0A4_MCL1-02      ttcccggaccacctgcggaagacgacgctggaagtggtaggccgctacct
A0A803T0A4_MCL1-03      ttcccggaccacctgcggaagacgacgctggaagtggtaggccgctacct
                        **************************************************

A0A803T0A4_MCL1-01      gcgcgaggccgccgacgaggccgggtccaaaggcaccgggcccaagttct
A0A803T0A4_MCL1-02      gcgcgaggccgccgacgaggccgggtccaaaggcaccgggcccaagttct
A0A803T0A4_MCL1-03      gcgcgaggccgccgacgaggccgggtccaaaggcaccgggcccaagttct
                        **************************************************

A0A803T0A4_MCL1-01      ccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggag
A0A803T0A4_MCL1-02      ccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggag
A0A803T0A4_MCL1-03      ccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggag
                        **************************************************

A0A803T0A4_MCL1-01      gtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctccggga
A0A803T0A4_MCL1-02      gtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctccggga
A0A803T0A4_MCL1-03      gtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctccggga
                        **************************************************

A0A803T0A4_MCL1-01      gaagcacctgctggccttccaaggaatgcttagaaagttggaaataaaga
A0A803T0A4_MCL1-02      gaagcacctgctggccttccaaggaatgcttagaaagttggaaataaaga
A0A803T0A4_MCL1-03      gaagcacctgctggccttccaaggaatgcttagaaagttggaaataaaga
                        **************************************************

A0A803T0A4_MCL1-01      aagaagaggacttggcgtctgtggcagaagtgacaacagaggtcttcaga
A0A803T0A4_MCL1-02      aagaagaggacttggcgtctgtggcagaagtgacaacagaggtcttcaga
A0A803T0A4_MCL1-03      aagaagaggacttggcgtctgtggcagaagtgacaacagaggtcttcaga
                        **************************************************

A0A803T0A4_MCL1-01      gatggcataataaactggggccgcattgtgactctcatctcttttggtgc
A0A803T0A4_MCL1-02      gatggcataataaactggggccgcattgtgactctcatctcttttggtgc
A0A803T0A4_MCL1-03      gatggcataataaactggggccgcattgtgactctcatctcttttggtgc
                        **************************************************

A0A803T0A4_MCL1-01      ctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaaca
A0A803T0A4_MCL1-02      ctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaaca
A0A803T0A4_MCL1-03      ctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaaca
                        **************************************************

A0A803T0A4_MCL1-01      ctttaatagaaattatcactgatgtgctggtgacggacaagagagaatgg
A0A803T0A4_MCL1-02      ctttaatagaaattatcactgatgtgctggtgacggacaagagagaatgg
A0A803T0A4_MCL1-03      ctttaatagaaattatcactgatgtgctggtgacggacaagagagaatgg
                        **************************************************

A0A803T0A4_MCL1-01      ctattgaaacataatgcctggcaacgtgctcggctcggcagcgccactct
A0A803T0A4_MCL1-02      ctattgaaacataatgcctggcaacgtgctcggctcggcagcgccactct
A0A803T0A4_MCL1-03      ctattgaaacataatgcctggga--gggatttgttcagttcttccatgta
                        ********************* *  * * *  * ** *     ***    

A0A803T0A4_MCL1-01      gcggatccacctcgaagcagtcactctcgttttcctcaattttcaagtcc
A0A803T0A4_MCL1-02      gcggatccacctcgaagcagtcactctcgttttcctcaattttcaagtcc
A0A803T0A4_MCL1-03      gagg----acatagaaggtggca---------tcaggaat------gttc
                        * **    ** * ****  * **         **   ***      ** *

A0A803T0A4_MCL1-01      aggctgttttcgtccgccatggcttccttggatctgagagaggaaagcag
A0A803T0A4_MCL1-02      aggctgttttcgtccgccatggcttccttggatctgagagaggaaagcag
A0A803T0A4_MCL1-03      tggtggcttttgccag-tgtggc-----tgga----ataggggcaggc-t
                         **  * *** * * *   ****     ****    * ** ** * **  

A0A803T0A4_MCL1-01      cagcacaactgtgt--ctga
A0A803T0A4_MCL1-02      cagcacacctgtcc--gtga
A0A803T0A4_MCL1-03      tggcctacatgatccggtga
                          **  *  **      ***

© 1998-2022Legal notice