Dataset for CDS MCL-1 of organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H9GEA6_MCL1-02      ------------------------------------------------atggccccgaac
H9GEA6_MCL1-01      atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaac
                                                                    ************

H9GEA6_MCL1-02      acgccggcctcacctggagccggcggaggcgtcggagaaagtagcggcgggaataataac
H9GEA6_MCL1-01      acgccggcctcacctggagccggcggaggcgtcggagaaagtagcggcgggaataataac
                    ************************************************************

H9GEA6_MCL1-02      gacggcggcggcgtctcggttccgaaggcctcaggtcttttctcagagaggccgcgccct
H9GEA6_MCL1-01      gacggcggcggcgtctcggttccgaaggcctcaggtcttttctcagagaggccgcgccct
                    ************************************************************

H9GEA6_MCL1-02      ctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
H9GEA6_MCL1-01      ctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
                    ************************************************************

H9GEA6_MCL1-02      tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
H9GEA6_MCL1-01      tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
                    ************************************************************

H9GEA6_MCL1-02      ccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagccgaggaggag
H9GEA6_MCL1-01      ccggcctccctgccgctgcctgaaggggagctcgacggctgcgaggaagccgaggaggag
                    ************************************************************

H9GEA6_MCL1-02      gaggccgcgacggtgccgtcttccaccccctcgccggacaaagagatggcggaggaggaa
H9GEA6_MCL1-01      gaggccgcgacggtgccgtcttccaccccctcgccggacaaagagatggcggaggaggaa
                    ************************************************************

H9GEA6_MCL1-02      ggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
H9GEA6_MCL1-01      ggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
                    ************************************************************

H9GEA6_MCL1-02      gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccggg
H9GEA6_MCL1-01      gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccggg
                    ************************************************************

H9GEA6_MCL1-02      cccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggag
H9GEA6_MCL1-01      cccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaacgaggcggag
                    ************************************************************

H9GEA6_MCL1-02      gtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctccgggagaagcacctg
H9GEA6_MCL1-01      gtggcgcgcgcgctggagacgctgcgccgggtgggcgagagcctccgggagaagcacctg
                    ************************************************************

H9GEA6_MCL1-02      ctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
H9GEA6_MCL1-01      ctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
                    ************************************************************

H9GEA6_MCL1-02      gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtg
H9GEA6_MCL1-01      gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtg
                    ************************************************************

H9GEA6_MCL1-02      actctcatctcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaat
H9GEA6_MCL1-01      actctcatctcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaat
                    ************************************************************

H9GEA6_MCL1-02      gctatcaacactttaatagaaattatcactgatgtgctggtgacggacaagagagaatgg
H9GEA6_MCL1-01      gctatcaacactttaatagaaattatcactgatgtgctggtgacggacaagagagaatgg
                    ************************************************************

H9GEA6_MCL1-02      ctattgaaacataatgcctgggagggatttgttcagttcttccatgtagaggacatagaa
H9GEA6_MCL1-01      ctattgaaacataatgcctggca-------------------------------------
                    ********************* *                                     

H9GEA6_MCL1-02      ggtggcatcaggaatgttctggtggcttttgccagtgtggctggaataggggcaggcttg
H9GEA6_MCL1-01      -------------------------------caactgtgtctga----------------
                                                   * * **** ***                 

H9GEA6_MCL1-02      gcctacatgatccggtga
H9GEA6_MCL1-01      ------------------
                                      

© 1998-2020Legal notice