Dataset for CDS BCL-2-like of organism Crocodylus porosus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7M4EPU7_BCL2-01      atgtcttc------------------------------------------
A0A7M4G2E0_BCL2-03      atggctaa------------------------------------------
A0A7M4EJG9_BCL2L1-      atgtcgag------------------------------------------
A0A7M4FFQ8_BCL2A1-      atg--gaa------------------------------------------
A0A7M4G2E0_BCL2-01      atg--gaggctgggagattatttcagccaaaaagaatacatgtaagaacc
A0A7M4G2E0_BCL2-02      atg--gaggctg--------------------------------------
                        ***                                               

A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A7M4G2E0_BCL2-01      aggatgtctcaaacagacagacctcaccgagataagccataccgatacta
A0A7M4G2E0_BCL2-02      --------------------------------------------------
                                                                          

A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A7M4G2E0_BCL2-01      cgagagccatggttatgacaggcacaacacagacagaaggactaaagaac
A0A7M4G2E0_BCL2-02      --------------------------------------------------
                                                                          

A0A7M4EPU7_BCL2-01      -------------------cacagtgaaaacaggctatcataaccgggag
A0A7M4G2E0_BCL2-03      -------------------tcctgggagaagaggctatgataaccgggag
A0A7M4EJG9_BCL2L1-      -------------------------------------cagcaaccgggaa
A0A7M4FFQ8_BCL2A1-      --------------------------------------agc-actgagtt
A0A7M4G2E0_BCL2-01      catacccatcccacggaaggtcagcaaaagagactcacagc-acccagaa
A0A7M4G2E0_BCL2-02      ------------------ggtcagcaaaagagactcacagc-acccagaa
                                                                  **   *  

A0A7M4EPU7_BCL2-01      atagtgctaaagtacatccattacaaactatcacagaggggat-------
A0A7M4G2E0_BCL2-03      atagtgctgaagtacatccattacaaactgtcacagagggggt-------
A0A7M4EJG9_BCL2L1-      ttagtgattgactttatatcctacaagctgtcacagcggggacacagctg
A0A7M4FFQ8_BCL2A1-      ct------------------------------------------------
A0A7M4G2E0_BCL2-01      ctccagaccttccagactttgttcagatccttataaaaaaaac-------
A0A7M4G2E0_BCL2-02      ctccagaccttccagactttgttcagatccttataaaaaaaac-------
                         *                                                

A0A7M4EPU7_BCL2-01      ----------------------------acgactgggc------------
A0A7M4G2E0_BCL2-03      ----------------------------acgactgggc------------
A0A7M4EJG9_BCL2L1-      gagtcagcttgaggggcaggatgagaccaggactgagtttgc--------
A0A7M4FFQ8_BCL2A1-      -------------------------------gttatgtttgc--------
A0A7M4G2E0_BCL2-01      ---------------gcagtatcaactcatggctacgtcagctcttctcc
A0A7M4G2E0_BCL2-02      ---------------gcagtatcaactcatggctacgtcagctcttctcc
                                                         *  *             

A0A7M4EPU7_BCL2-01      -------------------------------------------------t
A0A7M4G2E0_BCL2-03      -------------------------------------------------t
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      -------------------------------------------------t
A0A7M4G2E0_BCL2-01      tcacttttatcctcccaaacagaccttttcagagaaatgtgcaaacatat
A0A7M4G2E0_BCL2-02      tcacttttatcctcccaaacagaccttttcagagaaatgtgcaaacatat
                                                                          

A0A7M4EPU7_BCL2-01      gcccaccaagacagagcatgg----tgtcc--------tctgagtctctc
A0A7M4G2E0_BCL2-03      gcccaccaagacagagcacgg----ggtcc--------tccgagtcattc
A0A7M4EJG9_BCL2L1-      ----agaagaggaggacatggcaagtgtcc----cgaatgggagtccgtc
A0A7M4FFQ8_BCL2A1-      gcttagtccaagattatctgaaatatgttcttcaggaatcacagcctgga
A0A7M4G2E0_BCL2-01      gctcaacaagaggtattttgaaatttgtt-----gaaattacagtcagca
A0A7M4G2E0_BCL2-02      gctcaacaagaggtattttgaaatttgtt-----gaaattacagtcagca
                            *              *      **          *   ** *    

A0A7M4EPU7_BCL2-01      tcctgctgctgc----tgttgctgctgctgggacttcctctgacaatact
A0A7M4G2E0_BCL2-03      tcctgctgctgc----tgttgctgctgctgggacttcctctgaccatgct
A0A7M4EJG9_BCL2L1-      c--------------------tggcatc--------ccactgcca-----
A0A7M4FFQ8_BCL2A1-      c--------------------cagc--c--------cca--agca-----
A0A7M4G2E0_BCL2-01      ttctgatgctgatttgtgttgcagctgc--------cca--gaca-----
A0A7M4G2E0_BCL2-02      ttctgatgctgatttgtgttgcagctgc--------cca--gaca-----
                                               **  *        **     *      

A0A7M4EPU7_BCL2-01      gggctggtgtctctgcatcgtgagcctgctggctcagctgctgctagtaa
A0A7M4G2E0_BCL2-03      gggccggtgtctctgcatcctgagcctgctggctcagctgctgctagtaa
A0A7M4EJG9_BCL2L1-      --------------gccacgt-----------------agtgaatg----
A0A7M4FFQ8_BCL2A1-      --------------g-----------------------agtggctc----
A0A7M4G2E0_BCL2-01      --------------gccatttcaggctacacctccatcggcggcttggga
A0A7M4G2E0_BCL2-02      --------------gccatttcaggctacacctccatcggcggcttggga
                                      *                        *    *     

A0A7M4EPU7_BCL2-01      tgtgcctcctggtaatgacctgggcccagtcctacaggct----------
A0A7M4G2E0_BCL2-03      tgtgcctcctggtaatgagccgggcccagccccacaggct----------
A0A7M4EJG9_BCL2L1-      --gggctgctg-----gacacaggaacaacctggaagcccaggagagtgt
A0A7M4FFQ8_BCL2A1-      atgttttacga-----aacattgcatcctctttgca--------------
A0A7M4G2E0_BCL2-01      atgggctcctt-----cagcctggataccgcttacagccca---------
A0A7M4G2E0_BCL2-02      atgggctcctt-----cagcctggataccgcttacagccca---------
                              * *        *    *            *              

A0A7M4EPU7_BCL2-01      -------------gtccacctgaccctgcgccaagcgggagatgatttct
A0A7M4G2E0_BCL2-03      -------------gtccacctgaccctgcgccaagcgggagatgatttct
A0A7M4EJG9_BCL2L1-      tccagcggctgaagtgcggcaggcgctaagggaggcaggagacgagttt-
A0A7M4FFQ8_BCL2A1-      ----------aaag---ga----aactgaagagaatctaaagccattctt
A0A7M4G2E0_BCL2-01      -------tttgaag---gatatgaactgaaggaggtgagagacc-----t
A0A7M4G2E0_BCL2-02      -------tttgaag---gatatgaactgaaggaggtgagagacc-----t
                                     *           **            *          

A0A7M4EPU7_BCL2-01      -----------------------------cctgccgctaccagag---tg
A0A7M4G2E0_BCL2-03      -----------------------------cccgccgctaccagag---tg
A0A7M4EJG9_BCL2L1-      ----------------gagctgag------------gtaccgcag---gg
A0A7M4FFQ8_BCL2A1-      ggaca-----------cacttgaa-----ttttcatctatagaag--ttg
A0A7M4G2E0_BCL2-01      ggacatgcagttcagccagatgagagccccttgtgtgtacgggggcattg
A0A7M4G2E0_BCL2-02      ggacatgcagttcagccagatgagagccccttgtgtgtacgggggcattg
                                                             **     *    *

A0A7M4EPU7_BCL2-01      acgttgcc------------caaatgtctggccagctgcacttgaccccc
A0A7M4G2E0_BCL2-03      actttgcc------------caaatgtctggccagctgcacttgaccccc
A0A7M4EJG9_BCL2L1-      ccttcagc------------gacctcacatcccagctccacatcacccct
A0A7M4FFQ8_BCL2A1-      cc--------------agaagaattttcacccaagtta-----------t
A0A7M4G2E0_BCL2-01      ccttcagcctgacaatggctgcacttacactcctgttcctcgtcg---tt
A0A7M4G2E0_BCL2-02      ccttcagcctgacaatggctgcacttacactcctgttcctcgtcg---tt
                         *                      *  *   *  * *             

A0A7M4EPU7_BCL2-01      ttcacag------------------ccaggaggcgttttatggcag-tag
A0A7M4G2E0_BCL2-03      ttcacag------------------ccagggggcgctttgtggcgg-tag
A0A7M4EJG9_BCL2L1-      ggcacag-------------------cataccagagcttcgaacaggtgg
A0A7M4FFQ8_BCL2A1-      ggagcaa---gaatttgctg-atggcaatacca--actggggacggattt
A0A7M4G2E0_BCL2-01      ggggcaaagcaaattcatcgtctctccatgccactgctcgtggcagaatg
A0A7M4G2E0_BCL2-02      ggggcaaagcaaattcatcgtctctccatgccactgctcgtggcagaatg
                            **                     *         *     * *    

A0A7M4EPU7_BCL2-01      tagaggaactgttccgagatggagtgaactggggaagaattgtagccttc
A0A7M4G2E0_BCL2-03      tggaggagctgttccgagacggagtgaactgggggagaattgtggccttc
A0A7M4EJG9_BCL2L1-      tgaatgaactgttccgggatggagtgaactgggggcgcatcgtggc---c
A0A7M4FFQ8_BCL2A1-      tgac---aatatttatgtttggag-------gaattgtcactaaga----
A0A7M4G2E0_BCL2-01      tgcctttgatattctggctggtat-------ggcatacatctcagc---c
A0A7M4G2E0_BCL2-02      tgcctttgatattctggctggtat-------ggcatacatctcagc---c
                        *        * **       * *        *            *     

A0A7M4EPU7_BCL2-01      tttgggttcggtggcgtga---tgtgcgt---ggagaa---------tgt
A0A7M4G2E0_BCL2-03      tttgagttcggtggcgtga---tgtgcgt---ggagag---------tgt
A0A7M4EJG9_BCL2L1-      tttttctccttcggaggggccttgtgtgt---ggagag---------tgt
A0A7M4FFQ8_BCL2A1-      ---ggcttcaagagcatggagttcagcttacaggagaa------------
A0A7M4G2E0_BCL2-01      gttggcctcta---cctgtattttgtcatccaggtgaacacaacagatgt
A0A7M4G2E0_BCL2-02      gttggcctcta---cctgtattttgtcatccaggtgaacacaacagatgt
                                *        *    *     *   ** **             

A0A7M4EPU7_BCL2-01      caaccaggagatgtcgcccctcgtggacaacattgcaacatggatgatgg
A0A7M4G2E0_BCL2-03      caaccgggagatgtcgcccctcgtggacaacattgcaacatggatgacgg
A0A7M4EJG9_BCL2L1-      cgacaaggaaatgcaggtgctggttggacgtatcatctcatggatgacca
A0A7M4FFQ8_BCL2A1-      ----aataaagagcagatttca------tatttcatcacagag---taca
A0A7M4G2E0_BCL2-01      atgcaagaggagggagaggttg------ta-tgcacgccggggatacaca
A0A7M4G2E0_BCL2-02      atgcaagaggagggagaggttg------ta-tgcacgccggggatacaca
                                    *  *                      *   *       

A0A7M4EPU7_BCL2-01      agtatctgaacaggcacctccagaactggatccaggacaacggag-----
A0A7M4G2E0_BCL2-03      agtacctgaacaggcacctccagaactggatccaggacaatggag-----
A0A7M4EJG9_BCL2L1-      cctacctgaccgaccacctcgacccctggattcaggagaacggcg-----
A0A7M4FFQ8_BCL2A1-      tc-a--tgaacaacaaggctga---atggatagaggcaaatggag-----
A0A7M4G2E0_BCL2-01      tcaa--tgaactgcgaggtgca---ggggggcgatgcagctgttgctgtc
A0A7M4G2E0_BCL2-02      tcaa--tgaactgcgaggtgca---ggggggcgatgcagctgttgctgtc
                           *  *** *    *     *     **    * *     *  *     

A0A7M4EPU7_BCL2-01      gctggga-------tgccttcatagaattgtatggtaacaacatgagact
A0A7M4G2E0_BCL2-03      gctggga-------tgccttcgtggaattgtatggtaacaacatgagacc
A0A7M4EJG9_BCL2L1-      gttgggagcg---------------gttcgtggatctctatggcgatga-
A0A7M4FFQ8_BCL2A1-      gttgggaaaatggcttccttatgaagtttg--------agggtcagaaat
A0A7M4G2E0_BCL2-01      tttggtattgtggctgcct------gtttgtacttcccaagctctgtcat
A0A7M4G2E0_BCL2-02      tttggtattgtggctgcct------gtttgtacttcccaagctctgtcat
                          *** *                    * *                    

A0A7M4EPU7_BCL2-01      gttgattgacttcttctggatctc--------ttggaaaac--------t
A0A7M4G2E0_BCL2-03      attgattgacttctcctggatctc--------ttggaaaac--------t
A0A7M4EJG9_BCL2L1-      cgctgcagccaagagccgg----------------agaggccaggagcgt
A0A7M4FFQ8_BCL2A1-      cgtggctgtccttatttga-------------tgtgaaggcaagaatcat
A0A7M4G2E0_BCL2-01      ctgcgctcgcaccattcggaccgtgaggaacttccggaggcaccagacac
A0A7M4G2E0_BCL2-02      ctgcgctcgcaccattcggaccgtgaggaacttccggaggcaccagacac
                                 *       *                   *  *         

A0A7M4EPU7_BCL2-01      atcataagtctggttctggtggga--------------------------
A0A7M4G2E0_BCL2-03      atcttaagtctggttctggtggga--------------------------
A0A7M4EJG9_BCL2L1-      ttcaacaagtggctcctgaccggggccacggtggctggcgt---------
A0A7M4FFQ8_BCL2A1-      ggct----------------------------------------------
A0A7M4G2E0_BCL2-01      agcctcagtacagcccagagagcagctacagagagagaggccaccacaaa
A0A7M4G2E0_BCL2-02      agcctcagtacagcccagagagcagctacagagagagaggccaccacaaa
                          *                                               

A0A7M4EPU7_BCL2-01      ----------gcttgcatcactcttggtgct------tatctaggacata
A0A7M4G2E0_BCL2-03      ----------gcttgcatcactcttggcgct------tatctaggacata
A0A7M4EJG9_BCL2L1-      ----------gcttctgctgggctctctgct------cagccgcaa----
A0A7M4FFQ8_BCL2A1-      ----------gtctt-----ctccttcttca----------gtcaatatt
A0A7M4G2E0_BCL2-01      gccaacagaagccctgaaagcacccgcagcatgcaggcagtggcaacgtt
A0A7M4G2E0_BCL2-02      gccaacagaagccctgaaagcacccgcagcatgcaggcagtggcaacgtt
                                  *           *      *               *    

A0A7M4EPU7_BCL2-01      agtaa--
A0A7M4G2E0_BCL2-03      agtga--
A0A7M4EJG9_BCL2L1-      ---gtag
A0A7M4FFQ8_BCL2A1-      actga--
A0A7M4G2E0_BCL2-01      ggtgtag
A0A7M4G2E0_BCL2-02      ggtgtag
                               

© 1998-2021Legal notice