Dataset for CDS BCL-2 of organism Junco hyemalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5IH35_BCL2-01      atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctcta
A0A8C5IH35_BCL2-02      atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctcta
A0A8C5IH35_BCL2-05      atg-----------------------------------------------
A0A8C5IH35_BCL2-03      atg-----------------------------------------------
A0A8C5IH35_BCL2-04      atg-----------------------------------------------
                        ***                                               

A0A8C5IH35_BCL2-01      catggtgtcgccgcttatcagccccaagtcgctgaagctgcccggcgcgc
A0A8C5IH35_BCL2-02      catggtgtcgccgcttatcagccccaagtcgctgaagctgcccggcgcgc
A0A8C5IH35_BCL2-05      ------------gctcat-----ccggggagaagaggctac---------
A0A8C5IH35_BCL2-03      ------------gctcat-----ccggggagaagaggctac---------
A0A8C5IH35_BCL2-04      ------------gctcat-----ccggggagaagaggctac---------
                                    *** **     **  *  *  ** *** *         

A0A8C5IH35_BCL2-01      acgtcgtggtaactggaggctccagtggaattggaaaatgcattgctatt
A0A8C5IH35_BCL2-02      acgtcgtggtaactggaggctccagtggaattggaaaatgcattgctatt
A0A8C5IH35_BCL2-05      -------gataaccgggagat-------agtgctgaagtacatc------
A0A8C5IH35_BCL2-03      -------gataaccgggagat-------agtgctgaagtacatc------
A0A8C5IH35_BCL2-04      -------gataaccgggagat-------agtgctgaagtacatc------
                               * **** **  * *       * *    ** * ***       

A0A8C5IH35_BCL2-01      gaatgctataagcaaggtgctttcataacactgattgcaagggatgagaa
A0A8C5IH35_BCL2-02      gaatgctataagcaaggtgctttcataacactgattgcaagggatgagaa
A0A8C5IH35_BCL2-05      ---cactataaac-----tctctcag------------aggggatacgac
A0A8C5IH35_BCL2-03      ---cactataaac-----tctctcag------------aggggatacgac
A0A8C5IH35_BCL2-04      ---cactataaac-----tctctcag------------aggggatacgac
                             ****** *      ** ***             * *****  ** 

A0A8C5IH35_BCL2-01      caagctgttgcagacgaaga-aggaaatagaaaagtactctgttaatgac
A0A8C5IH35_BCL2-02      caagctgttgcagacgaaga-aggaaatagaaaagtactctgttaatgac
A0A8C5IH35_BCL2-05      tggcc---tgccagcgaggacagggcat---------ccctgtctc----
A0A8C5IH35_BCL2-03      tggcc---tgccagcgaggacagggcat---------ccctgtctc----
A0A8C5IH35_BCL2-04      tggcc---tgccagcgaggacagggcat---------ccctgtctc----
                            *   ***   *** ** ***  **         * ****       

A0A8C5IH35_BCL2-01      aagcaggttgtactctgtatttctgttgatgtgtctaaagactatgaaca
A0A8C5IH35_BCL2-02      aagcaggttgtactctgtatttctgttgatgtgtctaaagactatgaaca
A0A8C5IH35_BCL2-05      ---caggt----ctctctgctcctgctgctgctgctg-------------
A0A8C5IH35_BCL2-03      ---caggt----ctctctgctcctgctgctgctgctg-------------
A0A8C5IH35_BCL2-04      ---caggt----ctctctgctcctgctgctgctgctg-------------
                           *****    **** *  * *** ** **   **              

A0A8C5IH35_BCL2-01      agtggaaaatgttctaaaacaggctcaggagaagttggggccagttgata
A0A8C5IH35_BCL2-02      agtggaaaatgttctaaaacaggctcaggagaagttggggccagttgata
A0A8C5IH35_BCL2-05      -----------------------------------------cggttgctg
A0A8C5IH35_BCL2-03      -----------------------------------------cggttgctg
A0A8C5IH35_BCL2-04      -----------------------------------------cggttgctg
                                                                 * **** * 

A0A8C5IH35_BCL2-01      tgctcgtgaactgtgcaggaacatcagttacaggcaaatttgaggatatt
A0A8C5IH35_BCL2-02      tgctcgtgaactgtgcaggaacatcagttacaggcaaatttgaggatatt
A0A8C5IH35_BCL2-05      c------------tgctgggac----------------------------
A0A8C5IH35_BCL2-03      c------------tgctgggac----------------------------
A0A8C5IH35_BCL2-04      c------------tgctgggac----------------------------
                                     *** ** **                            

A0A8C5IH35_BCL2-01      gaagtgaattcttttgaaagattaatggcagtgaattacctgggcagtgt
A0A8C5IH35_BCL2-02      gaagtgaattcttttgaaagattaatggcagtgaattacctgggcagtgt
A0A8C5IH35_BCL2-05      --------ttcctctg--------atcacactg--------ggccggtgt
A0A8C5IH35_BCL2-03      --------ttcctctg--------atcacactg--------ggccggtgt
A0A8C5IH35_BCL2-04      --------ttcctctg--------atcacactg--------ggccggtgt
                                *** * **        **  ** **        ** * ****

A0A8C5IH35_BCL2-01      ttacccaagccgagc-------agtaatcgctaccatgaaggagcgcaga
A0A8C5IH35_BCL2-02      ttacccaagccgagc-------agtaatcgctaccatgaaggagcgcaga
A0A8C5IH35_BCL2-05      ctccgcaccccgagccccccggctcggctgctgctagccacgcgcccccg
A0A8C5IH35_BCL2-03      ctccgcaccccgagccccccggctcggctgctgctagccacgcgcccccg
A0A8C5IH35_BCL2-04      ctccgcaccccgagccccccggctcggctgctgctagccacgcgcccccg
                         * * **  ******              *** * *   * * ** *   

A0A8C5IH35_BCL2-01      atgggaaggattgtcttcgtgtcgtctcaggctggccagctgggcctgt-
A0A8C5IH35_BCL2-02      atgggaaggattgtcttcgtgtcgtctcaggctggccagctgggcctgt-
A0A8C5IH35_BCL2-05      gccgaggggctgcgccccg---caccccaggtcgtgcacctcgtcctgcg
A0A8C5IH35_BCL2-03      gccgaggggctgcgccccg---caccccaggtcgtgcacctcgtcctgcg
A0A8C5IH35_BCL2-04      gccgaggggctgcgccccg---caccccaggtcgtgcacctcgtcctgcg
                           *   ** *   *  **   *  * ****  *  ** ** * ****  

A0A8C5IH35_BCL2-01      ttggatatacagcttattctcccaccaagtttgctcttcgaggg--ttgg
A0A8C5IH35_BCL2-02      ttggatatacagcttattctcccaccaagtttgctcttcgaggg--ttgg
A0A8C5IH35_BCL2-05      ccaggcgggggacgagttctcccgac------gctaccagagggacttcg
A0A8C5IH35_BCL2-03      ccaggcgggggacgagttctcccgac------gctaccagagggacttcg
A0A8C5IH35_BCL2-04      ccaggcgggggacgagttctcccgac------gctaccagagggacttcg
                           *        *   *******  *      ***    *****  ** *

A0A8C5IH35_BCL2-01      ct--gaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacgg
A0A8C5IH35_BCL2-02      ct--gaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacgg
A0A8C5IH35_BCL2-05      cccagatgtccggccagctg--------------------cacctgacgc
A0A8C5IH35_BCL2-03      cccagatgtccggccagctg--------------------cacctgacgc
A0A8C5IH35_BCL2-04      cccagatgtccggccagctg--------------------cacctgacgc
                        *   ** * ** ** *   *                     ** * *** 

A0A8C5IH35_BCL2-01      tggcctatcctccagatactgatactcctggctttgcagaagaaagtaaa
A0A8C5IH35_BCL2-02      tggcctatcctccagatactgatactcctggctttgcagaagaaagtaaa
A0A8C5IH35_BCL2-05      c--cctcacggccaggagccgct--tcgtggcggtggtggaggagct---
A0A8C5IH35_BCL2-03      c--cctcacggccaggagccgct--tcgtggcggtggtggaggagct---
A0A8C5IH35_BCL2-04      c--cctcacggccaggagccgct--tcgtggcggtggtggaggagct---
                           ***  *  ****   * * *  ** ****  **  * ** *  *   

A0A8C5IH35_BCL2-01      acaaagcccttagagacgaagctgattt--------ctgaaacctcatct
A0A8C5IH35_BCL2-02      acaaagcccttagagacgaagctgattt--------ctgaaacctcatct
A0A8C5IH35_BCL2-05      -------cttccgcgatggggttaactggggcaggattgtggcct--tct
A0A8C5IH35_BCL2-03      -------cttccgcgatggggttaactggggcaggattgtggcct--tct
A0A8C5IH35_BCL2-04      -------cttccgcgatggggttaactggggcaggattgtggcct--tct
                               * *  * ** *  * * * *          **   ***  ***

A0A8C5IH35_BCL2-01      gtttgccaagcagagcaagttgccagagttatagtgaaagatgccataca
A0A8C5IH35_BCL2-02      gtttgccaagcagagcaagttgccagagttatagtgaaagatgccataca
A0A8C5IH35_BCL2-05      tcgagttcggcggtgtgatgtgc----------gtggagagcgtcaaccg
A0A8C5IH35_BCL2-03      tcgagttcggcggtgtgatgtgc----------gtggagagcgtcaaccg
A0A8C5IH35_BCL2-04      tcgagttcggcggtgtgatgtgc----------gtggagagcgtcaaccg
                            *    ** * *  *  ***          *** *    * **  * 

A0A8C5IH35_BCL2-01      agggaacttcaacagctcagttggatcagatggttacatgctgtcaatat
A0A8C5IH35_BCL2-02      agggaacttcaacagctcagttggatcagatggttacatgctgtcaatat
A0A8C5IH35_BCL2-05      ggagatgtctcac--ctcg--tggacagcat-------cgccgcctggat
A0A8C5IH35_BCL2-03      ggagatgtctcac--ctcg--tggacagcat-------cgccgcctggat
A0A8C5IH35_BCL2-04      ggagatgtctcac--ctcg--tggacagcat-------cgccgcctggat
                         * **  *   **  ***   ****    **        ** * *   **

A0A8C5IH35_BCL2-01      tgacaagtgggatgtcaccagtcacttctattactgaaggtcttcagca-
A0A8C5IH35_BCL2-02      tgacaagtgggatgtcaccagtcacttctattactgaaggtcttcagca-
A0A8C5IH35_BCL2-05      gaccgagt---acctgaaccggcagctgcacaactgga----tccaggac
A0A8C5IH35_BCL2-03      gaccgagt---acctgaaccggcagctgcacaactgga----tccaggac
A0A8C5IH35_BCL2-04      gaccgagt---acctgaaccggcagctgcacaactgga----tccaggac
                           * ***   *  * * * * **  *  *  **** *    * *** * 

A0A8C5IH35_BCL2-01      -----------ggatgcctttgtggagttgtatggcaatggaatgaggc-
A0A8C5IH35_BCL2-02      -----------ggttgtttgcatgggcatttttcgca-----------t-
A0A8C5IH35_BCL2-05      aacggaggctggatttca-----ggatctgtcagt--gtgaaaggatgc-
A0A8C5IH35_BCL2-03      aacggaggctgggatgcctttgtggagttgtatggcaatggaatgaggc-
A0A8C5IH35_BCL2-04      aacggaggctggagctac-agaaggactggcttggcagtggcctgtcgca
                                   *           **                         

A0A8C5IH35_BCL2-01      --------ctttgttcgat-ttctcctggatctctctgaagactatcctg
A0A8C5IH35_BCL2-02      --------cattggcctat-tttacctaggaagttttgacagc-atagtt
A0A8C5IH35_BCL2-05      tttaattcctgtgcccggtcttcaacttg--cttcttgcaccatacccca
A0A8C5IH35_BCL2-03      --------ctttgttcgat-ttctcctggatctctctgaagactatcctg
A0A8C5IH35_BCL2-04      cttggcaactttttttgacgttgacgtggggaacactgaag--------g
                                *  *        **    * *       **            

A0A8C5IH35_BCL2-01      agtc------tggttctggtgggag----------------cttgca---
A0A8C5IH35_BCL2-02      cgtcgctgcatgatgcaaagggaaa-------------------------
A0A8C5IH35_BCL2-05      tata------tgaaccttat-taataaatggct--------cttcca--g
A0A8C5IH35_BCL2-03      agtc------tggttctggtgggag----------------cttgca---
A0A8C5IH35_BCL2-04      gatg------cagttggtgtgggagaaacaactgtgtttgtcttgcagtg
                          *                    *                          

A0A8C5IH35_BCL2-01      ------tcactcttggcgcttatctcggacataaatag
A0A8C5IH35_BCL2-02      --------aatctgaaagtgcagataaaac-tgagtaa
A0A8C5IH35_BCL2-05      agtggctttgtatgtggtcatgc--------ttggtag
A0A8C5IH35_BCL2-03      ------tcactcttggcgcttatctcggacataaatag
A0A8C5IH35_BCL2-04      atgggttccctctttgggcacac----aacctaa----
                                  * *                  *      

© 1998-2022Legal notice