Dataset for CDS BCL2L1 of organism Oncorhynchus mykiss

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A060XE41_BCL2L1-      atgcacaaaaatggaatttaccttttaaaaaatcgatacttatttattga
A0A060XE41_BCL2L1-      at------------------------------------------------
A0A286MU87_BCL2L1-      at------------------------------------------------
                        **                                                

A0A060XE41_BCL2L1-      acggtacttgagtcttatttgcaattacctgggtttagcagtgcagtatt
A0A060XE41_BCL2L1-      -----------gtctta--------------------------cagta--
A0A286MU87_BCL2L1-      -----------gtctta--------------------------cagta--
                                   ******                          *****  

A0A060XE41_BCL2L1-      tcaagggtatgataacttgttgcagcccagaggaaactgccagacagcaa
A0A060XE41_BCL2L1-      ----------------------------acagggaactggtgg------t
A0A286MU87_BCL2L1-      ----------------------------acagggaactggtgg------t
                                                    * *** *****   *       

A0A060XE41_BCL2L1-      gcctttattccagacatctcagttagtgtgagctatagactgtcccagag
A0A060XE41_BCL2L1-      gttttt--------------------tataagctatagactgtcccagag
A0A286MU87_BCL2L1-      gttttt--------------------tataagctatagactgtcccagag
                        *  ***                    * * ********************

A0A060XE41_BCL2L1-      gaattattcatgttgtcaattggggctggagggtgcaagtggacggactg
A0A060XE41_BCL2L1-      gaattattcatgttgtcaattggggctggagggtgcaagtggacggactg
A0A286MU87_BCL2L1-      gaattattcatgttgtcaattggggctggagggtgcaagtggacggactg
                        **************************************************

A0A060XE41_BCL2L1-      acggagatgaggccattgcaaatgggtctgtggggaactaccggaacagc
A0A060XE41_BCL2L1-      acggagatgaggccattgcaaatgggtctgtggggaactaccggaacagc
A0A286MU87_BCL2L1-      acggagatgaggccattgcaaatgggtctgtggggaactaccggaacagc
                        **************************************************

A0A060XE41_BCL2L1-      agaagcaatttggcgaagccctcatctccacaggggggcatggagccagt
A0A060XE41_BCL2L1-      agaagcaatttggcgaagccctcatctccacaggggggcatggagccagt
A0A286MU87_BCL2L1-      agaagcaatttggcgaagccctcatctccacaggggggcatggagccagt
                        **************************************************

A0A060XE41_BCL2L1-      gaaagcagcactacgggactcagtggatgagtttgagctacgctacaccc
A0A060XE41_BCL2L1-      gaaagcagcactacgggactcagtggatgagtttgagctacgctacaccc
A0A286MU87_BCL2L1-      gaaagcagcactacgggactcagtggatgagtttgagctacgctacaccc
                        **************************************************

A0A060XE41_BCL2L1-      gtgccttcagtgacctctcctcccagctccacatcacccctgccacagcc
A0A060XE41_BCL2L1-      gtgccttcagtgacctctcctcccagctccacatcacccctgccacagcc
A0A286MU87_BCL2L1-      gtgccttcagtgacctctcctcccagctccacatcacccctgccacagcc
                        **************************************************

A0A060XE41_BCL2L1-      taccacagctttgagagtgtgatggacgaagtgttcagggacggggtcaa
A0A060XE41_BCL2L1-      taccacagctttgagagtgtgatggacgaagtgttcagggacggggtcaa
A0A286MU87_BCL2L1-      taccacagctttgagagtgtgatggacgaagtgttcagggacggggtcaa
                        **************************************************

A0A060XE41_BCL2L1-      ctggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttg
A0A060XE41_BCL2L1-      ctggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttg
A0A286MU87_BCL2L1-      ctggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttg
                        **************************************************

A0A060XE41_BCL2L1-      agtgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattgg
A0A060XE41_BCL2L1-      agtgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattgg
A0A286MU87_BCL2L1-      agtgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattgg
                        **************************************************

A0A060XE41_BCL2L1-      atgaccacctatctggacaaccatatccagccctggatccagagccaagg
A0A060XE41_BCL2L1-      atgaccacctatctggacaaccatatccagccctggatccagagccaagg
A0A286MU87_BCL2L1-      atgaccacctatctggacaaccatatccagccctggatccagagccaagg
                        **************************************************

A0A060XE41_BCL2L1-      cggatgggaccgttttgcagagatctttggcagagatgctgctgcagacg
A0A060XE41_BCL2L1-      cggatgggaccgttttgcagagatctttggcagagatgctgctgcagacg
A0A286MU87_BCL2L1-      cggatgg---------gcagagatctttggcagagatgctgctgcagacg
                        *******         **********************************

A0A060XE41_BCL2L1-      ttcgacggtcccaggagagcataattaaatggctgctagttggggtgatt
A0A060XE41_BCL2L1-      ttcgacggtcccaggagagcataattaaatggctgctagttggggtgatt
A0A286MU87_BCL2L1-      ttcgacggtctcaggagagcataattaaatggctgctagttggggtgatt
                        ********** ***************************************

A0A060XE41_BCL2L1-      ctgctttcaggagtgctggtcggcactctcatcatgaagaaacgccaatg
A0A060XE41_BCL2L1-      ctgctttcaggagtgctggtcggcactctcatcatgaagaaacgccaatg
A0A286MU87_BCL2L1-      ctgctttcaggagtgctggtcggcactctcatcatgaagaaacgccagtg
                        *********************************************** **

A0A060XE41_BCL2L1-      a
A0A060XE41_BCL2L1-      a
A0A286MU87_BCL2L1-      a
                        *

© 1998-2020Legal notice