Dataset for CDS BCL-2 of organism Oreochromis aureus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A668TEB6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=1017 residues).
atgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagcc
tctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctaca
agcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgcc
atcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaaca
ggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtgg
aggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctactc
cccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtgg
catacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctgaa
acctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagctctgt
cggtccagatggttacatgctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagg
atgcatttgtggagctgtacgacagacagagggactccgtcttcagctgctcctggccctccatcaagacagttttcggc
ttggctgcgctcggagcggccagtctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A668TEB6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=1080 residues).
atgtcctctgaagaagggttcagctcagcgataacagattggctttttatcaatacctggtggctccttcttccgttcat
catgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagc
ctctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctac
aagcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgc
catcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaac
aggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtg
gaggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccat
gaaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctact
ccccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtg
gcatacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctga
aacctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagctctg
tcggtccagatggttacatgctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcag
attgtcaccatgggattgtttcggaccatcgcacttttttacctggggagctttgacagcatcgtgcgccgctgtatgat
tcaaagggagcagtcaaaagcggccaataagagggagtaa
>gnl|bcl2dbcds|A0A668TEB6_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=894 residues).
atgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagcc
tctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctaca
agcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgcc
atcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaaca
ggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtgg
aggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctactc
cccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtgg
catacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctgaa
acctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcaattgtcaccatgggattgtttcggac
catcgcacttttttacctggggagctttgacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaaagcggcca
ataagagggagtaa
>gnl|bcl2dbcds|A0A668TEB6_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=561 residues).
atgtcctctgaagaagggttcagctcagcgataacagattggctttttatcaatacctggtggctccttcttccgttcat
catgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagc
ctctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctac
aagcaaggagcgttcatcactttggtggcacgagacgaggtggtgctctgcatctcagttgatgtttccagtgattacag
tcaagtggaaaacgtgataaaacaggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcag
tttctgggaagtttgaggaagtggaggtagatcgttttaaaattgtcaccatgggattgtttcggaccatcgcacttttt
tacctggggagctttgacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaaagcggccaataagagggagta
a
>gnl|bcl2dbcds|A0A668TEB6_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=687 residues).
atggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcggggatacgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggttcaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctccgccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggagtgaactggggccgga
ttattgctttcttcgagtttgggggcacggtgtgcgtggaatgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagctgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagtctcaccatcggagcataccttacacaaaagtga
© 1998-2020Legal notice